白介素1β(IL1b)引物對
Primer Pair for Interleukin 1 Beta (IL1b)
IL1-B; IL1-Beta; IL1F2; IL-1β; Interleukin-1 Family Member 2; Catabolin
- 編號PGA563Bo02
- 物種Bos taurus; Bovine (Cattle,牛) 相同的名稱,不同的物種。
- 適用片段Met1~Pro266
- 上游引物CGGAATTCATGGCAACCGTACCTGAACCC
- 下游引物CCGCTCGAGTTAGGGAGAGAGGGTTTCCATTC
- 純化方式RPC
- 酶切位點5'-EcoRI, 3'-XhoI
- 解鏈溫度55-60℃
- 性狀凍干粉
- 應用PCR
- 下載 英文說明書 中文說明書
- 規格 1 OD
- 價格 ¥ 360
- 欲了解實際交易價格和更多情況,請與當地經銷商聯系!
用法
利用無菌水稀釋到10-100uM,可渦旋混勻。
儲存
避免反復凍融。2-8°C不超過一個月,-20°C不超過12個月。
贈品
增值服務
引物對定制服務
重組蛋白定制服務
基因克隆/PCR實驗服務
PCR預混液
耐熱性DNA聚合酶
實時熒光定量PCR實驗服務
相關產品
編號 | 適用物種:Bos taurus; Bovine (Cattle,牛) | 應用(僅供研究使用,不用于臨床診斷!) |
RPA563Bo02 | 白介素1β(IL1b)重組蛋白 | Positive Control; Immunogen; SDS-PAGE; WB. |
RPA563Bo01 | 白介素1β(IL1b)重組蛋白 | Positive Control; Immunogen; SDS-PAGE; WB. |
PAA563Bo02 | 白介素1β(IL1b)多克隆抗體 | WB; IHC; ICC; IP. |
PAA563Bo01 | 白介素1β(IL1b)多克隆抗體 | WB; IHC; ICC; IP. |
MAA563Bo21 | 白介素1β(IL1b)單克隆抗體 | WB; IHC; ICC; IP. |
SEA563Bo | 白介素1β(IL1b)檢測試劑盒(酶聯免疫吸附試驗法) | Enzyme-linked immunosorbent assay for Antigen Detection. |
MEA563Bo | 白介素1β(IL1b)檢測試劑盒(酶聯免疫吸附試驗法,小樣本) | Enzyme-linked immunosorbent assay for Antigen Detection. |
LMA563Bo | 白介素1β(IL1b)等多因子檢測試劑盒(流式熒光發光法) | FLIA Kit for Antigen Detection. |
KSA563Bo01 | 白介素1β(IL1b)檢測試劑盒DIY材料(酶聯免疫吸附試驗法) | Main materials for "Do It (ELISA Kit) Yourself". |
PGA563Bo02 | 白介素1β(IL1b)引物對 | PCR |
CGA563Bo02 | 白介素1β(IL1b)cDNA | PCR、蛋白表達等 |
參考文獻
雜志 | 參考文獻 |
Respiration | Protective Effect of Nicotine on Lipopolysaccharide-Induced Acute Lung Injury in Mice [Karger: 000319151] |
Experimental Gerontology | Prophylactic lithium alleviates postoperative cognition impairment by phosphorylating hippocampal glycogen synthase kinase-3β (Ser9) in aged rats [ScienceDirect: S0531556511002373] |
New Zealand Veterinary Journal | Dominant expression of interleukin-8 vs interleukin-1β and tumour necrosis factor alpha in lungs of lambs experimentally infected with Mannheimia haemolytica. [Tandfonline: 596180] |
The Journal of Urology | Improvement by Phytotherapeutic Agent of Detrusor Overactivity, Down-Regulation of Pharmacological Receptors and Urinary Cytokines in Rats with Cyclophosphamide Induced Cystitis [PubMed: S0022534712049087] |
Journal of Periodontology Online | The Effect of Radachlorin-Mediated Antimicrobial Photodynamic Therapy on Clinical Parameters and Cytokine Profile in Ligature-Induced Periodontitis in Dogs [PubMed: 22813345] |
PLoS One | Recombinant Adiponectin Ameliorates Liver Ischemia Reperfusion Injury via Activating the AMPK/eNOS Pathway [PubMed: PMC3676360] |
Lower Urinary Tract Symptoms | Effects of Saw Palmetto Extract on Urodynamic Parameters, Bladder Muscarinic and Purinergic Receptors and Urinary Cytokines in Rats with Cyclophosphamide-Induced Cystitis [Onlinelibrary: luts.12015] |
PLoS ONE | A Combinatorial Relative Mass Value Evaluation of Endogenous Bioactive Proteins in Three-Dimensional Cultured Nucleus Pulposus Cells of Herniated Intervertebral Discs: Identification of Potential Target Proteins for Gene Therapeutic Approaches [Plosone: Source] |
Journal of natural remedies | Ixora coccinea down Regulate the Inflammation-Associated Prostaglandins (PGE-2), Nitric Oxide (NO) and Cytokines Production in LPS-Stimulated RAW 264.7 Macrophage [Jnronline: Source] |
The Veterinary Journal | Quantitative assessment of hsp70, IL-1β and TNF-α in the spinal cord of dogs with E40K SOD1-associated degenerative myelopathy [Pubmed: 24662024] |
British Journal of Nutrition | n-6: n-3 PUFA ratio is involved in regulating lipid metabolism and inflammation in pigs [Pubmed: 23947577] |
AGE | Estrogen deficiency does not decrease the in vitro osteogenic potential of rat adipose-derived mesenchymal stem cells [Pubmed: 24687841] |
Inflamm Res. | Intracranial injection of recombinant stromal-derived factor-1 alpha (SDF-1α) attenuates traumatic brain injury in rats. [Pubmed: 24352531] |
Journal of Clinical Periodontology | Experimental peri-implant mucositis at different implant surfaces. [Pubmed: 24521508] |
Physiological Research | Budesonide added to modified porcine surfactant Curosurf may additionally improve the lung functions in meconium aspiration syndrome. [Pubmed: 2432969] |
International immunopharmacology | Ruscogenin attenuates monocrotaline-induced pulmonary hypertension in rats [Pubmed: 23538027] |
Journal of Pharmaceutical Sciences and Pharmacology | Anti-inflammatory Effect of Euphorbia hirta Leaf Extract in Rats and Modulation of Inflammation-Associated Prostaglandins (PGE-2) and Nitric Oxide (NO) Expression in RAW264.7 Macrophage [Ingentaconnect: Source] |
Mediators of Inflammation | Protective Effects of Pretreatment with Oleanolic Acid in Rats in the Acute Phase of Hepatic Ischemia-Reperfusion Injury: Role of the PI3K/Akt Pathway [Hindawi: 451826] |
Journal of Periodontology | Effects of Photodynamic Therapy on the Clinical and Gingival Crevicular Fluid Inflammatory Biomarkers in Chronic Periodontitis: A Split-Mouth Randomized Clinical Trial [Joponline: 130464] |
Antimicrobial Agents and Chemotherapy | The antimicrobial peptide OH-CATH30 as a potential therapy for antibiotic-resistant Pseudomonas aeruginosa keratitis [Asm:Source] |
INTERNATIONAL JOURNAL OF MEDICINE AND MEDICAL RESEARCH | L-ARGININE, BUT NOT L-NAME PROTECTS AGAINST LIVER INJURY INDUCED BY EXPERIMENTAL ISCHEMIA-REPERFUSION [Tdmu:Source] |
Basic & Clinical Pharmacology & Toxicology | Treatment with Carnitine Enhances Bone Fracture Healing under Osteoporotic and/or Inflammatory Conditions [Wiley:Source] |
Evidence-Based Complementary and Alternative Medicine | Ginsenosides Rg1 from Panax ginseng: A Potential Therapy for Acute Liver Failure Patients? [Pubmed:Pmc4241314] |
36 | MRTF-A steers an epigenetic complex to activate endothelin-induced pro-inflammatory transcription in vascular smooth muscle cells [Pubmed:Pmc4176337] |
Cell Death Dis. | MicroRNA-30d regulates cardiomyocyte pyroptosis by directly targeting foxo3a in diabetic cardiomyopathy [Pubmed:Pmc4237254] |
Inflamm Res. | Intracranial injection of recombinant stromal-derived factor-1 alpha (SDF-1α) attenuates traumatic brain injury in rats [Pubmed:24352531] |
J Clin Periodontol. | Experimental peri‐implant mucositis at different implant surfaces [Pubmed:24521508] |
Inflammation | Effects of honokiol on sepsis-induced acute kidney injury in an experimental model of sepsis in rats [Pubmed:24531855] |
Antimicrob Agents Chemother. | Therapeutic potential of the antimicrobial peptide OH-CATH30 for antibiotic-resistant Pseudomonas aeruginosa keratitis [Pubmed:24637683] |
British Journal of Nutrition | Grape seed extract supplementation attenuates the heat stress-induced responses of jejunum epithelial cells in Simmental?×?Qinchuan steers [Pubmed:24846452] |
J Surg Res. | Valproic acid protects septic mice from renal injury by reducing the inflammatory response [Pubmed:24948542] |
Inflammation.? | Alpha-lipoic acid exerts anti-inflammatory effects on lipopolysaccharide-stimulated rat mesangial cells via inhibition of nuclear factor kappa B (NF-κB) signaling pathway. [Pubmed:24962643] |
Archives of Oral Biology | Hyperlipidemia causes changes in inflammatory responses to periodontal pathogen challenge: Implications in acute and chronic infections [Pubmed:24992577] |
Investigative ophthalmology & visual science | TSG-6 Protects Corneal Endothelium From Transcorneal Cryoinjury in Rabbits [Pubmed:25034606] |
Connective Tissue Research | Metabolic and cytoprotective effects of in vivo peri-patellar hyaluronic acid injections in cultured tenocytes [Pubmed:25333747] |
Oncotarget | Senescence of tumor cells induced by oxaliplatin increases the efficiency of a lipid A immunotherapy via the recruitment of neutrophils [Pubmed:25347345] |
Molecular Medicine Reports | GYY4137, a hydrogen sulfide?releasing molecule, inhibits the inflammatory response by suppressing the activation of nuclear factor?kappa B and mitogen?activated protein kinases in Coxsackie virus B3?infected rat cardiomyocytes. [Pubmed:25377925] |
Neural Regen Res.? | Inflammatory response and neuronal necrosis in rats with cerebral ischemia [Pubmed:25422636] |
International Immunopharmacology | NF-κB activation and proinflammatory cytokines mediated protective effect of Indigofera caerulea Roxb. on CCl 4 induced liver damage in rats [Pubmed:25445959] |
Journal of Surgical Research | Ursolic acid improves survival and attenuates lung injury in septic rats induced by cecal ligation and puncture [Pubmed:25454976] |
Journal of Surgical Research | Melatonin attenuates intestinal ischemia–reperfusion-induced lung injury in rats by upregulating N-myc downstream-regulated gene 2 [Pubmed:25491174] |
Journal of Translational Medicine | Protective effects of astaxanthin against ischemia/reperfusion induced renal injury in mice [Pubmed:25623758] |
Molecular Medicine Reports | Tanshinone ⅡA attenuates bleomycin-induced pulmonary fibrosis in rats [Pubmed:25672255] |
International Journal of Clinical and Experimental Pathology | Panax notoginseng saponins promote wound repair of anterior cruciate ligament through phosphorylation of PI3K, AKT and ERK [Pubmed:25755732] |
Mediators of Inflammation | Effect of TLR4/MyD88 Signaling Pathway on Expression of IL-1β and TNF-α in Synovial Fibroblasts from Temporomandibular Joint Exposed to Lipopolysaccharide [Pubmed:25810567] |
Int J Clin Exp Pathol | Rosiglitazone attenuates renal injury caused by hyperlipidemic pancreatitis [PubMed: 26191125] |
Clinical and Experimental Pharmacology and Physiology | Curcumin alleviates lung injury in diabetic rats by inhibiting nuclear factor‐κB pathway [PubMed: 26111829] |
Drug Des Devel Ther | Cardioprotection against ischemia/reperfusion injury by QiShenYiQi Pill [PubMed: 26109848] |
Endocrine Journal | Relationship between serum secreted frizzled-related protein 4 levels and the first-phase of glucose-stimulated insulin secretion in individuals with different glucose tolerance [PubMed: 26041556] |
Int J Clin Exp Pathol | Effects of dexmedetomidine on the protection of hyperoxia-induced lung injury in newborn rats [PubMed: 26261523] |
Biomed Res Int | Basic Fibroblast Growth Factor Ameliorates Endothelial Dysfunction in Radiation-Induced Bladder Injury [PubMed: 26351640] |
Front Pharmacol | Glycyrrhizic acid alleviates bleomycin-induced pulmonary fibrosis in rats [PubMed: 26483688] |
Mol Med Rep | Roles of lipoxin A4 receptor activation and anti-interleukin-1β antibody on the toll-like receptor 2/mycloid differentiation factor 88/nuclear factor-κB pathway in airway inflammation induced by ovalbumin [PubMed: 25760938] |
Life Sci | Betulin attenuates kidney injury in septic rats through inhibiting TLR4/NF-κB signaling pathway [PubMed: 26656467] |
Asian Pac J Trop Med | Effect of SecinH3 on lung injury induced by sepsis of rats [PubMed: 26706678] |
PLOS ONE | Penehyclidine Hydrochloride Preconditioning Provides Cardioprotection in a Rat Model of Myocardial Ischemia/Reperfusion Injury [PubMed: 26632817] |
Int Immunopharmacol | Betulin attenuates lung and liver injuries in sepsis [PubMed: 26644168] |
Journal of Histochmistry and Cytochmistry | Epigallocatechin-3-Gallate Attenuates Unilateral Ureteral Obstruction-Induced Renal Interstitial Fibrosis in Mice [PubMed: 25549657] |
J Histochem Cytochem | Glycyrrhizic Acid Prevents Sepsis-Induced Acute Lung Injury and Mortality in Rats [PubMed: 26385569] |
Anim Reprod Sci. | Alteration in peripheral blood concentration of certain pro-inflammatory cytokines in cows developing retention of fetal membranes [PubMed: 25851495] |
Cell Physiol Biochem | MicroRNA-155 Promotes Atherosclerosis Inflammation via Targeting SOCS1 [PubMed: 26159489] |
Journal of Medicinal Food | A Standardized Extract of [PubMed: 26501382] |
journal of veterinary science | Autologous processed plasma: cytokine profile and effects upon injection into healthy equine joints [PubMed: 25269714] |
Clin Exp Pharmacol Physiol | Silymarin attenuates paraquat-induced lung injury via Nrf2-mediated pathway in vivo and in vitro [PubMed: 26173462] |
Immunologic Research | Mesenchymal stromal cell-dependent reprogramming of Kupffer cells is mediated by TNF-α and PGE2 and is crucial for liver transplant tolerance [PubMed: 25982496] |
Journal of Surgical Research | Cyanidin-3-O-glucoside attenuates acute lung injury in sepsis rats [PubMed: 26152793] |
Life Sciences | Neuroprotective effect of allicin in a rat model of acute spinal cord injury [PubMed: 26546416] |
International Journal of Immunopathology & Pharmacology | Sea buckthorn (Hippophae rhamnoides L.) oil protects against chronic stress-induced inhibitory function of natural killer cells in rats [PubMed: 26684638] |
Arquivos Brasileiros de Oftalmologia | Effects of morphine on the expression of cytokines and inflammatory mediators in a rabbit model of endotoxin-induced experimental uveitis [PubMed: 26677041] |
Neuropeptides | Melanocortin MC6 receptor agonists alleviate brain damage in abdominal compartment syndrome in the rat [PubMed: 25616531] |
The American Journal of Sports Medicine | Differential Interactive Effects of Cartilage Traumatization and Blood Exposure In Vitro and In Vivo [PubMed: 26362437] |
MEDICAL SCIENCES | ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ЭФФЕКТИВНОСТИ РАЗНЫХ МЕТОДОВ СТИМУЛЯЦИИ РЕПАРАТИВНОГО ОСТЕОГЕНЕЗА В ЭКСПЕРИМЕНТЕ [Article: N] |
Медицина и здравоохранение | ДИНАМИКА ЦИТОКИНОВОГО ПРОФИЛЯ В ОЦЕНКЕ ЭФФЕКТИВНОСТИ РАЗНЫХ МЕТОДОВ СТИМУЛЯЦИИ РЕПАРАТИВНОГО ОСТЕОГЕНЕЗА В ЭКСПЕРИМЕНТЕ [Article: N] |
Journal of Equine Veterinary Science | Synovial Fluid and Serum Concentrations of Interleukin-1 Receptor Antagonist and Interleukin-2 [Science: Article] |
Mediators Inflamm | Effect of TLR4/MyD88 Signaling Pathway on Expression of IL-1 and TNF-in Synovial Fibroblasts from Temporomandibular Joint Exposed to Lipopolysaccharide [PubMed: 25810567] |
J Reprod Immunol | The immunomodulating effect of seminal plasma on T cells [PubMed: 25799173] |
J Thorac Cardiovasc Surg | Annexin V homodimer protects against ischemia reperfusion–induced acute lung injury in lung transplantation [PubMed: 26725713] |
J Breath Res | Effects of different ventilation strategies on exhaled nitric oxide in geriatric abdominal surgery [PubMed: 25719610] |
PLoS One | Low Shear Stress Induced HMGB1 Translocation and Release via PECAM-1/PARP-3 Pathway to Induce Inflammation Response [PubMed: 25793986] |
Fertil Steril | Inflammosome in the human endometrium: further step in the evaluation of the “maternal side” [PubMed: 26474737] |
J Biol Chem | The Blockade of NF-κB Activation by a Specific Inhibitory Peptide has a Strong Neuroprotective Role in a Sprague-Dawley Rat Kernicterus Model [PubMed: 26499797] |
J Vet Sci | Autologous processed plasma: cytokine profile and effects upon injection into healthy equine joints. [PubMed: 25269714] |
Mol Med Rep | Ameliorative effects of Gualou Guizhi decoction on inflammation in focal cerebral ischemic-reperfusion injury [PubMed: 25815894] |
J Interferon Cytokine Res | Aggregatibacter actinomycetemcomitans Invasion Induces Interleukin-1β Production Through Reactive Oxygen Species and Cathepsin B [PubMed: 25789553] |
удк | Циток [Cgi-Bin: Irbis_Nbuv] |
中華臨床醫生雜志 | 中性粒細胞明膠酶相關脂質運載蛋白對腹膜透析相關性腹膜炎療效監測的意義 [Journal: Fulltext] |
ANP | Oral PTCTS (Particulated Transialidase) Removes Serum Microparticles and Decreases Inflammation in Atherosclerotic Plaques of Rabbits [Journal: 60965] |
Immunol Res | Construction of recombinant Mip-FlaA dominant epitope vaccine against Legionella pneumophila and evaluation of the immunogenicity and protective immunity [PubMed: 26607265] |
The Journal of Nutritional Biochemistry | Protective role of n6/n3 PUFA supplementation with varying DHA/EPA ratios against atherosclerosis in mice [Pubmed:27142749] |
Infaction and Immunity | Biological Activities of Uric Acid in Infection Due to Enteropathogenic and Shiga-Toxigenic Escherichia coli [Pubmed:26787720] |
Scientific Reports | Cellular uptake of exogenous calcineurin B is dependent on TLR4/MD2/CD14 complexes, and CnB is an endogenous ligand of TLR4 [Pubmed:27090571] |
Journal of Translational Medicine | Modulation of the sympathetic nervous system by renal denervation prevents reduction of aortic distensibility in atherosclerosis prone ApoE-deficient rats [Pubmed:27277003] |
Genetics and Molecular Research | Effect of ozone on vascular endothelial growth factor (VEGF) and related inflammatory cytokines in rats with diabetic retinopathy [Pubmed:27323014] |
Journal of Equine Veterinary Science | Interleukin-1 Receptor Antagonist and Interleukin-1 Beta Levels in Equine Synovial Fluid of Normal and Osteoarthritic Joints: Influence of Anatomic Joint Location and Repeated Arthrocentesis [science:S0737080615300757] |
Chinese Chemical Letters | Screening the anti-gout traditional herbs from TCM using an in vitro method [science:S1001841716301450] |
Front Microbiol | Innate Immune Responses in ALV-J Infected Chicks and Chickens with Hemangioma In Vivo [Pubmed:27252695] |
PLoS One. | Molecular Mechanisms Responsible for Neuron-Derived Conditioned Medium (NCM)-Mediated Protection of Ischemic Brain [Pubmed:26745377] |
Neuroscience | The inhibition of transforming growth factor beta-activated kinase 1 contributed to neuroprotection via inflammatory reaction in pilocarpine-induced rats with epilepsy [Pubmed:27012613] |
Neuroscience | Bexarotene protects against traumatic brain injury in mice partially through apolipoprotein E [Pubmed:27235741] |
Research in Veterinary Science | A chimeric protein composed of the binding domains ofClostridium perfringens?phospholipase C and?Trueperella pyogenes?pyolysin induces partial immunoprotection in a mouse model [Pubmed:27473983] |
SpringerPlus | Ethyl pyruvate?attenuated?coxsackievirus?B3-induced?acute?viral?myocarditis?by?suppression?ofHMGB1/RAGE/NF-ΚB?pathway. [Pubmed:27026909] |
The Journal of Thoracic and Cardiovascular Surgery | Annexin V homodimer protects against ischemia reperfusiona??induced acute lung injury in lung transplantation [Pubmed:26725713] |
International Immunopharmacology | Consistency and pathophysiological characterization of a rat polymicrobial sepsis model via the improved cecal ligation and puncture surgery [Pubmed:26802602] |
J Stroke Cerebrovasc Dis. | Curcumin Attenuates Inflammation, Oxidative Stress, and Ultrastructural Damage Induced by Spinal Cord Ischemia–Reperfusion Injury in Rats [Pubmed:26935117] |
Scientific publications in peer reviewed journals | Evidence-based review of efficacy and adverse effects of joint medication and evaluation of synovial fluid and serum markers for osteoarthritis in the horse [receive:101658] |
Asian Pacific Journal of Tropical Medicine | Perfusion of gastrodin in abdominal aorta for alleviating spinal cord ischemia reperfusion injury [science:S1995764516300955] |
Life Sci. | Carcinoembryonic antigen related cellular adhesion molecule 1 alleviates dextran sulfate sodium-induced ulcerative colitis in mice [Pubmed:26898127] |
Biol Trace Elem Res. | Analysis of Ionomic Profiles of Canine Hairs Exposed to Lipopolysaccharide (LPS)-Induced Stress [Pubmed:26758868] |
Basic Clin Pharmacol Toxicol | Neuroprotective Effect of Ginsenoside Rd in Spinal Cord Injury Rats [Pubmed:26833867] |
Virol J | Classical swine fever virus NS5A protein changed inflammatory cytokine secretion in porcine alveolar macrophages by inhibiting the NF-κB signaling pathway [Pubmed:27296632] |
Int J Mol Sci. | Dexmedetomidine Protects Rat Liver against Ischemia-Reperfusion Injury Partly by the α2A-Adrenoceptor Subtype and the Mechanism Is Associated with the TLR4/NF-κB Pathway [Pubmed:27347929] |
Journal of Neuroinflammation | Upregulation of neuronal zinc finger protein A20 expression is required for electroacupuncture to attenuate the cerebral inflammatory injury mediated by the nuclear factor-kB signaling pathway in cerebral ischemia/reperfusion rats [pubmed:27716383] |
Journal of Agricultural Biotechnology | Gln Attenuates LPS-induced Inflammatory Injury of Bos taurus Testis Sustentacular Cells [10610] |
Front Pharmacol | Poria Attenuates Idiosyncratic Liver Injury Induced by Polygoni Multiflori Radix Praeparata [pubmed:27803670] |
Journal of Equine Veterinary Science | Evaluation of Two Protocols Using Autologous Conditioned Serum for Intra-articular Therapy of Equine Osteoarthritis—A Pilot Study Monitoring Cytokines and Cartilage-Specific Biomarkers [S0737080616303720] |
immunology letters | Recombinant Mip-PilE-FlaA dominant epitopes vaccine candidate against Legionella pneumophila. [pubmed:28366526] |
Lipids in Health and Disease | Protective effects of various ratios of DHA/EPA supplementation on high-fat diet-induced liver damage in mice. [pubmed:28356106] |
biomedicine & pharmacotherapy | Diosgenin ameliorates development of neuropathic pain in diabetic rats: Involvement of oxidative stress and inflammation. [pubmed:28033582] |
International Journal of Molecular Medicine | The neutrophil elastase inhibitor, sivelestat, attenuates sepsis-related kidney injury in rats [pubmed:27430552] |
Springerplus | Ethyl pyruvate attenuated coxsackievirus B3-induced acute viral myocarditis by suppression of HMGB1/RAGE/NF-ΚB pathway [pubmed:27026909] |
Andrology | Chronic prostatitis/chronic pelvic pain syndrome impairs erectile function through increased endothelial dysfunction, oxidative stress, apoptosis, and corporal fibrosis … [doi:10.1111] |
Molecular?Immunology | Targeted inhibition of GATA-6 attenuates airway inflammation and remodeling by regulating caveolin-1 through TLR2/MyD88/NF-κB in murine model of asthma [pubmed:27289030] |
Cellular?Physiology and?Biochemistry | The?Neuroprotective Effect?of?Puerarin?in?Acute?Spinal Cord Injury?Rats. [pubmed:27576607] |
Physiological Research | Intravenous dexamethasone attenuated inflammation and influenced apoptosis of lung cells in an experimental model of acute lung injury. [pubmed:28006948] |
World?Journal of Gastroenterology? | Alterations in gut microbiota during remission and recurrence of diabetes after duodenal-jejunal bypass in rats [pubmed:27547013] |
Journal of Orthopaedic?Surgery?and?Research? | No midterm advantages in the middle term using small intestinal submucosa and human amniotic membrane in Achilles tendon transverse tenotomy [pubmed:27881176] |
Molecular Medicine Reports | C?reactive protein/oxidized low density lipoprotein/β2?glycoprotein i complexes induce lipid accumulation and inflammatory reaction in macrophages via p38/mitogen? … [10.3892] |
Poultry?Science | ALV-J strain SCAU-HN06 induces innate immune responses in chicken primary monocyte-derived macrophages [pubmed:27486255] |
Molecular?Medicine?Reports | Zisheng Shenqi decoction ameliorates monosodium urate crystal-induced gouty arthritis in rats through anti-inflammatory and anti-oxidative effects [pubmed:27432278] |
International Journal of Molecular?Sciences | PEDF Inhibits the Activation of NLRP3 Inflammasome in Hypoxia Cardiomyocytes through PEDF Receptor/Phospholipase A2 [pubmed:27973457] |
The?American?Journal?of?Chinese?Medicine | Pinellia?ternata?Attenuates?Mucus?Secretion?and?Airway?Inflammation?after?InhaledCorticosteroid?Withdrawal?in?COPD?Rats. [pubmed:27430907] |
The Journal of Comenius University in Bratislava | Effects of Conventional Mechanical Ventilation Performed by Two Neonatal Ventilators on the Lung Functions of Rabbits with Meconium-Induced Acute Lung Injury [acm.2017.16.issue-3] |
Journal of Physiology and Pharmacology | Effects?of?budesonide?on the?lung?functions,?inflammation?and?apoptosis?in a?saline-lavagemodel?of?acute?lung?injury. [pubmed:28195073] |
Cellular?Physiology?and?Biochemistry | MiR-155?is?Involved?in?Renal?Ischemia-Reperfusion?Injury?via?Direct?Targeting?of?FoxO3a?andRegulating?Renal?Tubular?Cell?Pyroptosis. [pubmed:28006785] |
Oncotarget | Poly(ADP-ribose)?polymerase?1?inhibition?protects?cardiomyocytes?from?inflammation?andapoptosis?in?diabetic?cardiomyopathy. [pubmed:27027354] |
Life?Sciences | Bone fracture healing is delayed in splenectomic rats [pubmed:27956350] |
Sci Total Environ. | The?effects?of?particulate matter?on?inflammation?of?respiratory system:?Differences?betweenmale?and?female. [pubmed:28174048] |
Food Funct. | Flavonoids from sea buckthorn inhibit the lipopolysaccharide-induced inflammatory response in RAW264.7 macrophages through the MAPK and NF-κB pathways. [pubmed:28256654] |
PLoS One. | Self-complementary adeno-associated virus serotype 6 mediated knockdown of ADAMTS4 induces long-term and effective enhancement of aggrecan in degenerative human nucleus pulposus cells: A new therapeutic approach for intervertebral disc disorders. [pubmed:28207788] |
Cell Death Dis. | Salusin-β contributes to oxidative stress and inflammation in diabetic cardiomyopathy [pubmed:28333148] |
Journal of Photochemistry and Photobiology B: Biology | Efficacy of scaling and root planning with and without adjunct Nd:YAG laser therapy on clinical periodontal parameters and gingival crevicular fluid interleukin 1-beta and tumor necrosis factor-alpha levels among patients with periodontal disease: A prospective randomized split-mouth clinical study. [pubmed:28282558] |
Journal of Cellular Physiology | Autophagy maintains the integrity of endothelial barrier in LPS-induced lung injury. [pubmed:28328069] |
Biomedicine & pharmacotherapy= Biomedecine & pharmacotherapie | Protective effects of N-acetylcystein and atorvastatin against renal and hepatic injury in a rat model of intestinal ischemia-reperfusion [pubmed:28273631] |
Journal of Neurochemistry | β‐Caryophyllene protects in vitro neurovascular unit against oxygen‐glucose deprivation and re‐oxygenation‐induced injury [pubmed:27565895] |
Procalcitonin und proinflammatorische Zytokine in der bronchoalveol?ren Lavage beim lungenkranken Pferd unter inhalativer Glukokortikoidtherapie [FUDISS_thesis_000000103830] | |
Journal of Agricultural and Food Chemistry | Effect of boron on thymic cytokine expression, hormone secretion, antioxidant functions, cell proliferation, and apoptosis potential via the ERK1/2 signaling pathway [pubmed:29032684] |
PHYSIOLOGICAL RESEARCH | Selective Inhibition of NF-κB and Surfactant Therapy in Experimental Meconium-Induced Lung Injury [pubmed:28937237] |
MOLECULAR MEDICINE REPORTS | The effect of anagliptin on intimal hyperplasia of rat carotid artery after balloon injury [pubmed:28990108] |
Iranian Journal of Basic Medical Sciences | Naringin attenuates diabetic retinopathy by inhibiting inflammation, oxidative stress and NF-κB activation in vivo and in vitro [pubmed:28852447] |
Journal of Cellular Physiology | Increased Chondrogenic Potential of Mesenchymal Cells From Adipose Tissue Versus Bone Marrow‐Derived Cells in Osteoarthritic In Vitro Models [pubmed:27739057] |
Oral Diseases | Glucosamine oral administration as an adjunct to hyaluronic acid injection in treating temporomandibular joint osteoarthritis [pubmed:28862770] |
Biomedicine & Pharmacotherapy | Cytokine production in vitro and in rat model of colitis in response to Lactobacillus plantarum LS/07 [pubmed:28830068] |
Food & Function | Flavonoids from sea buckthorn inhibit the lipopolysaccharide-induced inflammatory response in RAW264. 7 macrophages through the MAPK and NF-κB … [DOI:10.1039/C6FO01873D] |
cellular?physiology and biochemistry | Hydrogen-Rich Saline Attenuates Brain Injury Induced by Cardiopulmonary Bypass and Inhibits Microvascular Endothelial Cell Apoptosis Via the PI3K/Akt/GSK3β … [pubmed:29040978] |
Microbial Immunology | Immunomodulatory Activities of a Fungal Protein Extracted from Hericium erinaceus through Regulating the Gut Microbiota [pubmed:28713364] |
Pesquisa Veterinária Brasileira | Efeito protetor do β-glucano e glutamina em les?es intestinais e imunológicas induzidas por ciratabina (Ara-C) em camundongos [10.159:s0100-736x2017000900013] |
Evidence-Based Complementary and Alternative Medicine | BuShenKangShuai tablet reduces atherosclerotic lesion by improving blood lipids metabolism and inhibiting inflammatory response via TLR4 and NF-κB signaling pathway [journals:1758383] |
Frontiers in Neurology | a-Asarone Attenuates Cognitive Deficit in a Pilocarpine-Induced Status Epilepticus Rat Model via a Decrease in the Nuclear Factor-觀B Activation and Reduction in Microglia Neuroinflammation. [pubmed:29312110] |
中國免疫學雜志 | b-caryophyllene mitigates cerebral ischemia reperfusion injury in mice by inhibiting HMGB1/ TLR4/ NFkB pathway [doi:10. 3969 / j. issn. 1000-484X. 2017. 07. 011] |
Chinese Journal of comparative medicine (中國比較醫學雜志) | 富氫液通過P13K通路減輕大鼠腦缺血再灌注損傷 [doi:10u3969.j.issn.1671-7856] |
PLoS One | Self-complementary adeno-associated virus serotype 6 mediated knockdown of ADAMTS4 induces long-term and effective enhancement of aggrecan in degenerative human nucleus pulposus cells: A new therapeutic approach for intervertebral disc disorders [10.1371:journal.pone.0172181] |
Experimentelle periimplant?re Mukositis an unterschiedlichen Implantatoberfl?chen [doi: 10.1111/jcpe.12240.] | |
International Journal of Biological Macromolecules | Chemical composition of Cyclocarya paliurus polysaccharide and inflammatory effects in lipopolysaccharide-stimulated RAW264.7 macrophage [pubmed:29032210] |
Journal of Photochemistry and Photobiology B: Biology | Efficacy of scaling and root planning with and without adjunct Nd:YAG laser therapy on clinical periodontal parameters and gingival crevicular fluid interleukin 1-beta and tumor necrosis factor-alpha levels among patients with periodontal disease: A prospective randomized split-mouth clinical study [10.1016/j.jphotobiol.2017.03.001] |
Frontiers in Neuroscience | Neuroprotective Effect of β-Caryophyllene on Cerebral Ischemia-Reperfusion Injury via Regulation of Necroptotic Neuronal Death and Inflammation: In Vivo and in Vitro [PMC5662640] |
International Journal of?Clinical?and Experimental Pathology | Platelet-derived growth factor and stromal cell-derived factor-1 promote the skin wound repairing effect of bone mesenchymal stem cells: a key role of matrix metalloproteinase 1 and collagens [ISSN:1936-2625/IJCEP0058424] |
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE | Ginsenoside Rg1 inhibits inflammatory responses via modulation of the nuclear factor?κB pathway and inhibition of inflammasome activation in alcoholic hepatitis [pubmed:29207044] |
Cellular Physiology and Biochemistry | Dexmedetomidine Alleviates HyperoxiaInduced Acute Lung Injury via Inhibiting NLRP3 Inflammasome Activation [pubmed:28873369] |
Tropical Journal of Pharmaceutical Research | Protective effect of salvianolic acid B against intestinal ischemia reperfusion-induced injury in a rat model [10.4314/tjpr.v16i10.17] |
Frontiers in Molecular Neuroscience | Electroacupuncture Suppresses the NF-κB Signaling Pathway by Upregulating Cylindromatosis to Alleviate Inflammatory Injury in Cerebral Ischemia/Reperfusion Rats [10.3389/fnmol.2017.00363] |
Scientific Reports | Optimization of Storage Temperature for Retention of Undifferentiated Cell Character of Cultured Human Epidermal Cell Sheets [pubmed:28811665] |
Oncotarget | Neuroprotection of Botch in experimental intracerebral hemorrhage in rats. [pubmed:29221132] |
PLoS One | Protective effect of aplysin on liver tissue and the gut microbiota in alcohol-fed rats [pubmed:28622357] |
Autonomic Neuroscience | Altered gastrointestinal motility in an animal model of Lesch-Nyhan disease. [pubmed:29305058] |
Endocrine, Metabolic & Immune Disorders-Drug Targets | Changes in Serum Nampt Levels and Its Significances in Diabetic Nephropathy Patients-The Potential Role of Nampt in T2DM with Diabetic Nephropathy. [pubmed:28699485] |
Biological Rhythm Research | A study of altered cytokine rhythms associated with successful implantation in cows [10.1080/09291016.2017.1361159] |
Biomedical and Environmental Sciences | Grape Seed Procyanidin Extract Reduces Arsenic-Induced Renal Inflammatory Injury in Male Mice. [pubmed:28756814] |
Acta Pharmacologica Sinica | Cis-stilbene glucoside in Polygonum multiflorum induces immunological idiosyncratic hepatotoxicity in LPS-treated rats by suppressing PPAR-γ. [pubmed:28649126] |
International journal of molecular medicine | Stromal-epithelial lactate shuttle induced by tumor?derived interleukin?1β promotes cell proliferation in oral squamous cell carcinoma [pubmed:29207019] |
Molecular Medicine Reports | Mild hypothermia pretreatment protects against liver ischemia reperfusion injury via the PI3K/AKT/FOXO3a pathway [pubmed:28944825] |
Veterinary microbiology | Secondary Haemophilus parasuis infection enhances highly pathogenic porcine reproductive and respiratory syndrome virus (HP-PRRSV) infection-mediated inflammatory responses. [pubmed:28532803] |
Biomedicine & pharmacotherapy | Berberine ameliorates intrahippocampal kainate-induced status epilepticus and consequent epileptogenic process in the rat: Underlying mechanisms [pubmed:28061403] |
International immunopharmacology | Low-dose SKA Progesterone and Interleukin-10 modulate the inflammatory pathway in endometriotic cell lines [pubmed:29272819] |
International immunopharmacology | Chronic dexamethasone treatment results in hippocampal neurons injury due to activate NLRP1 inflammasome in vitro [pubmed:28605710] |
Journal of Neuroinflammation | Chronic glucocorticoid exposure activates BK-NLRP1 signal involving in hippocampal neuron damage. [pubmed:28732502] |
Journal of Ethnopharmacology | Corydalis hendersonii Hemsl. protects against myocardial injury by attenuating inflammation and fibrosis via NF-κB and JAK2-STAT3 signaling pathways. [pubmed:28629818] |
Journal of Animal Science and Biotechnology | Plasma and cerebrospinal fluid interleukin-1β during lipopolysaccharide-induced systemic inflammation in ewes implanted or not with slow-release melatonin. [pubmed:29026538] |
Translational?Stroke?Research | Early Inflammatory Response in the Brain and Anesthesia Recovery Time Evaluation After Experimental Subarachnoid Hemorrhage [Pubmed:29926382] |
Journal?of?Controlled?Release | Nose-to-brain delivery of insulin enhanced by a nanogel carrier [Pubmed:29196041] |
PLOS?Pathogens | Cathepsin B aggravates coxsackievirus B3-induced myocarditis through activating the inflammasome and promoting pyroptosis [Pubmed:29360865] |
Cell?Death?&?Disease | AMP-activated protein kinase agonist N 6-(3-hydroxyphenyl) adenosine protects against fulminant hepatitis by suppressing inflammation and apoptosis [Articles:s41419-017-0118-0] |
Journal of?Neuroinflammation | Unconjugated bilirubin induces pyroptosis in cultured rat cortical astrocytes [Pubmed:29357878] |
Molecular Neurobiology | Neuroprotective Effects of Filgrastim in Rotenone-Induced Parkinson's Disease in Rats: Insights into its Anti-Inflammatory, Neurotrophic, and Antiapoptotic Effects [s12035-017-0855-1] |
Neuropharmacology | Levo-corydalmine alleviates vincristine-induced neuropathic pain in mice by inhibiting an NF-kappa B-dependent CXCL1/CXCR2 signaling pathway [Pubmed:29518397] |
Journal of Translational Medicine | Recurrent pregnancy loss is associated to leaky gut: a novel pathogenic model of endometrium inflammation? [Pubmed:29665864] |
Scientific Reports | Mesenchymal stromal cells inhibit NLRP3 inflammasome activation in a model of Coxsackievirus B3-induced inflammatory cardiomyopathy [Pubmed:29434214] |
American Journal of Physiology-Lung?Cellular?and Molecular Physiology | Maternal PUFA omega-3 supplementation prevents hyperoxia-induced pulmonary hypertension in the offspring [Pubmed:29597832] |
Food and Chemical Toxicology | Antioxidant, anti-inflammatory and synergistic anti-hyperglycemic effects of Malaysian propolis and metformin in streptozotocin–induced diabetic rats [Pubmed:30026088] |
International Journal of Biological Macromolecules | Alcohol accumulation promotes esophagitis via pyroptosis activation [Pubmed:30123073] |
Annals?of?Intensive?Care | Hypothermic total liquid ventilation after experimental aspiration-associated acute respiratory distress syndrome [Pubmed:29721820] |
British journal of nutrition | Phytic acid improves intestinal mucosal barrier damage and reduces serum levels of proinflammatory cytokines in a 1, 2-dimethylhydrazine-induced rat colorectal?… [Pubmed:29947321] |
Frontiers in Neurology | Ursolic Acid Ameliorates Inflammation in Cerebral Ischemia and Reperfusion Injury Possibly via High Mobility Group Box 1/Toll-Like Receptor 4/NFκB?… [Pubmed:29867706] |
Journal of Functional Foods | Hepatoprotective effect of flavonoid-enriched fraction from Cyclocarya paliurus leaves on LPS/D-GalN-induced acute liver failure [10.1016:j.jff.2018.07.031] |
Inflammopharmacology | Protective effect of isoliquiritigenin against cerebral injury in septic mice via attenuation of NF-κB [Pubmed:29943151] |
Food?&?Function | Asiatic acid suppresses neuroinflammation in BV2 microglia via modulation of the Sirt1/NF-κB signaling pathway [Pubmed:29354820] |
Life?Sciences | Lipoxin A4 may attenuate the progression of obesity-related glomerulopathy by inhibiting NF-κB and ERK/p38 MAPK-dependent inflammation [Pubmed:29499280] |
Life?Sciences | Modified porcine surfactant enriched by recombinant human superoxide dismutase for experimental meconium aspiration syndrome [Pubmed:29684443] |
Life?Sciences | Alamandine attenuates sepsis-associated cardiac dysfunction via inhibiting MAPKs signaling pathways [Pubmed:29679702] |
Brain?Research | Intra-arterial human urinary kallidinogenase alleviates brain injury in rats with permanent middle cerebral artery occlusion through PI3K/AKT/FoxO1 signaling pathway [Pubmed:29510144] |
Molecular Reproduction and Development? | A proinflammatory response of bovine endometrial epithelial cells to active sperm in vitro [Pubmed:29337420] |
International Endodontic Journal | Inhibition of SOX9 Promotes Inflammatory and Immune Responses of Dental Pulp [Pubmed:29571909] |
International Journal of Molecular?Medicine | MCMV triggers ROS/NLRP3-associated inflammasome activation in the inner ear of mice and cultured spiral ganglion neurons, contributing to sensorineural hearing?… [Pubmed:29512778] |
International Journal of Molecular?Medicine | Interleukin-1β induces intercellular adhesion molecule-1 expression, thus enhancing the adhesion between mesenchymal stem cells and endothelial progenitor cells?… [Pubmed:29393395] |
Neurochemical Research | E3 Ubiquitin Ligase c-cbl Inhibits Microglia Activation After Chronic Constriction Injury [Pubmed:29934689] |
PLoS One | Chitosan oligosaccharide ameliorates acute lung injury induced by blast injury through the DDAH1/ADMA pathway [Pubmed:29415054] |
Ultrasound?in Medicine &?Biology | Validation of Musculoskeletal Ultrasound in the Assessment of Experimental Gout Synovitis [Pubmed:29703511] |
BMC?Infectious Diseases | Development of tissue inflammation accompanied by NLRP3 inflammasome activation in rabbits infected with Treponema pallidum strain Nichols [Pubmed:29490620] |
Journal of Molecular Neuroscience | A Novel scFv Anti-Aβ Antibody Reduces Pathological Impairments in APP/PS1 Transgenic Mice via Modulation of Inflammatory Cytokines and Aβ-related Enzymes [Pubmed:30062438] |
Experimental?biology?and?medicine?(Maywood) | Shock waves increase pulmonary vascular leakage, inflammation, oxidative stress, and apoptosis in a mouse model [Pubmed:29984607] |
Innate?Immunity? | Lipoxin A attenuates LPS-induced acute lung injury via activation of the ACE2-Ang-(1-7)-Mas axis [Pubmed:29969931] |
Clinical?And Experimental Pharmacology And Physiology? | Diallyl sulfide alleviates cisplatin‐induced nephrotoxicity in rats via suppressing NF‐κB downstream inflammatory proteins and p53/Puma signalling pathway [Pubmed:29266336] |
Evidence-based?Complementary and Alternative?Medicine | Bushenkangshuai Tablet Reduces Atherosclerotic Lesion by Improving Blood Lipids Metabolism and Inhibiting Inflammatory Response via TLR4 and NF-κB Signaling?… [Pubmed:29619063] |
Evidence-Based?Complementary and Alternative Medicine | Tualang Honey Reduced Neuroinflammation and Caspase-3 Activity in Rat Brain after Kainic Acid-Induced Status Epilepticus [Pubmed:30108663] |
BMC?Veterinary?Research | Inflammatory pattern of the infrapatellar fat pad in dogs with canine cruciate ligament disease [Pubmed:29769086] |
Molecular Medicine Reports | Protective effects of N (2)?L?alanyl?L?glutamine mediated by the JAK2/STAT3 signaling pathway on myocardial ischemia reperfusion [Pubmed:29393473] |
Molecular?Medicine?Reports? | Hydrogen?rich solution against myocardial injury and aquaporin expression via the PI3K/Akt signaling pathway during cardiopulmonary bypass in rats [Pubmed:29956781] |
Molecular?Medicine?Reports | Epigallocatechingallate attenuates myocardial injury in a mouse model of heart failure through TGF?β1/Smad3 signaling pathway [Pubmed:29620209] |
Medical Science Monitor | Rho Kinase Type 1 (ROCK1) Promotes Lipopolysaccharide-induced Inflammation in Corneal Epithelial Cells by Activating Toll-Like Receptor 4 (TLR4)?… [Pubmed:29804125] |
Medical Science Monitor | Emodin Attenuates Bleomycin-Induced Pulmonary Fibrosis via Anti-Inflammatory and Anti-Oxidative Activities in Rats [Pubmed:29290631] |
Medical Science Monitor | Sulforaphane, a Natural Isothiocyanate Compound, Improves Cardiac Function and Remodeling by Inhibiting Oxidative Stress and Inflammation in a Rabbit?… [Pubmed:29527002] |
Experimental?Lung?Research | Anti-IL-8 antibody potentiates the effect of exogenous surfactant in respiratory failure caused by meconium aspiration [Pubmed:29324051] |
Human and Experimental Toxicology | Neuroprotective effect of agmatine (decarboxylated -arginine) against oxidative stress and neuroinflammation in rotenone model of Parkinson's disease [Pubmed:30001633] |
Oncology?Letters | Hydrogen?rich solution attenuates myocardial injury caused by cardiopulmonary bypass in rats via the Janus?activated kinase 2/signal transducer and activator of?… [Pubmed:29928398] |
Journal of?Maternal-Fetal?&?Neonatal?Medicine | Amniotic fluid HIF1α and exosomal HIF1α in cervical insufficiency patients with physical examination-indicated cerclage [Pubmed:29357727] |
Experimental and Therapeutic Medicine | S?adenosyl methionine regulates calcium channels and inhibits uterine smooth muscle contraction in rats with infectious premature delivery through the transient?… [Pubmed:29896230] |
Animal Production Science | Omega-3 fatty acids and meloxicam supplementation and the incidence and histopathological changes associated with femoral head syndrome in broilers [10.1071:AN17713] |
International?Journal?of?Clinical?and?Experimental?Medicine | BoNT-A attenuated pain of endometriosis by inhibiting microglia activation [files:ijcem0055240.pdf] |
International Journal of Pharmacology | Evaluation of Susceptibility and Innate Immune Response to Candida albicans in Mice with Sub-health [ijp.2018.689.697] |
Journal of?Diabetes?Investigation | Relationship between serum adipsin and the first phase of glucose‐stimulated insulin secretion in individuals with different glucose tolerance [Pubmed:29432659] |
Life?Sciences | Malaysian propolis, metformin and their combination, exert hepatoprotective effect in streptozotocin-induced diabetic rats [Pubmed: 30205096] |
International?Journal?of?Clinical?and?Experimental?Medicine | The relationship between autophagy and apoptosis of lamina propria dendritic cells from the small intestine on the immunodynamics of sepsis mice [] |
European?Journal of Pharmacology | Inhibition of Rho kinase by GSK 269962 reverses both corticosterone-induced detrusor overactivity and depression-like behaviour in rats [Pubmed: 30172788] |
Acta?Medica?Mediterranea | Effects of Conventional Mechanical Ventilation Performed by Two Neonatal Ventilators on the Lung Functions of Rabbits with Meconium-Induced Acute Lung?… [Doi: 10.1515/acm-2016-0012] |
IUBMB?Life | SLC1A2 mediates refractory temporal lobe epilepsy with an initial precipitating injury by targeting the glutamatergic synapse pathway [Pubmed: 30360015] |
Neurobiology of Disease | Glucagon-like peptide-2 reduces the obesity-associated inflammation in the brain [Pubmed: 30347266] |
Journal of?Dairy?Science | Metabolism and immune status during transition period influences the lactation performance in Zebu (Bos indicus () cows [Pubmed: 17430930] |
Microbial?Pathogenesis | Total flavones of fermentation broth by co-culture of Coprinus comatus and Morchella esculenta induces an anti-inflammatory effect on LPS-stimulated RAW264. 7?… [Pubmed: 30316005] |
Experimental?Cell?Research | LL-37 inhibits LPS-induced inflammation and stimulates the osteogenic differentiation of BMSCs via P2X7 receptor and MAPK signaling pathway [Pubmed: 30287143] |
Prostaglandins?&?Other?Lipid?Mediators | Detoxification and activating blood circulation decoction reduces restenosis involving the TLR4/NF-κB pathway after balloon injury [Pubmed: 30453089] |
Biomedicine?&?Pharmacotherapy | Potential mechanisms underlying the protective effects of salvianic acid A against atherosclerosis in vivo and vitro [] |
International Journal of Molecular?Sciences | Endothelial Microsomal Prostaglandin E Synthetase-1 Upregulates Vascularity and Endothelial Interleukin-1β in Deteriorative Progression of Experimental?… [Pubmed: 30463256] |
Oxidative medicine and cellular longevity | Dietary DHA/EPA Ratio Changes Fatty Acid Composition and Attenuates Diet-Induced Accumulation of Lipid in the Liver of ApoE?/? Mice [] |
Toxicology Mechanisms and?Methods | Long-term exposure to crotonaldehyde causes heart and kidney dysfunction through induction of inflammatory and oxidative damage in male Wistar rats [Pubmed: 30426860] |
BioMed Research International | α-Tocopherol Ameliorates Redox Equilibrium and Reduces Inflammatory Response Caused by Chronic Variable Stress [] |
PLoS One | Macrophage expression of E3 ubiquitin ligase Grail protects mice from lipopolysaccharide-induced hyperinflammation and organ injury [Pubmed: 30571701] |
BBA- Molecular Basis of Disease | Enhanced remedial effects for vitamin D3 and calcium co-supplementation against pre-existing lead nephrotoxicity in mice: The roles of renal calcium homeostatic?… [Pubmed: 30553018] |
Archives of Physiology and Biochemistry | Diabetes-induced testicular oxidative stress, inflammation, and caspase-dependent apoptosis: the protective role of metformin [Pubmed: 30513216] |
International Journal of Molecular Medicine | Ginsenoside Rg1 protects against H2O2?induced neuronal damage due to inhibition of the NLRP1 inflammasome signalling pathway in hippocampal neurons in vitro [Pubmed: 30535505] |
Journal of Veterinary?Research | Early cytokine response after vaccination with Coxiella burnetii phase I in an infected herd of dairy cattle [] |
Neurochemical Research | Sinomenine Attenuates Traumatic Spinal Cord Injury by Suppressing Oxidative Stress and Inflammation via Nrf2 Pathway [Pubmed: 30603983] |
EXPERIMENTAL ANIMALS | Protective effects of sulforaphane on diabetic retinopathy: activation of the Nrf2 pathway and inhibition of NLRP3 inflammasome formation [Pubmed: 30606939] |
ACS?Applied?Materials?&?Interfaces | Rebuilding post-infarcted cardiac functions by injecting TIIA@ PDA NPs-crosslinked ROS sensitive hydrogels [Pubmed: 30592403] |
Chinese Journal of Integrative Medicine | Electroacupuncture Delays Cartilage Degeneration by Modulating Nuclear Factor-κB Signaling Pathway [Pubmed: 30656598] |
Kidney?International | Wnt/β-catenin signaling mediates both heart and kidney injury in type 2 cardiorenal syndrome [Pubmed: 30770217] |
Inflammation | Honokiol Attenuates Sepsis-Associated Acute Kidney Injury the Inhibition of Oxidative Stress and Inflammation [Pubmed: 30680694] |
Toxicology | Bradykinin contributes to immune liver injury via B2R receptor-mediated pathways in trichloroethylene sensitized mice: a role in Kupffer cell activation [Pubmed: 30685357] |
Acta?Biochimica et?Biophysica Sinica | Adiponectin attenuates lipopolysaccharide-induced cell injury of H9c2 cells by regulating AMPK pathway [Pubmed: 30668810] |
Journal of?Neuroinflammation | Anti-inflammatory and cognitive effects of interferon-β1a (IFNβ1a) in a rat model of Alzheimer's disease [Pubmed: 30777084] |
Phytotherapy?Research | Synergistic enhancement and hepatoprotective effect of combination of total phenolic extracts of L. and methotrexate for treatment of rheumatoid?… [Pubmed: 30729592] |
Journal of Biological Sciences | Maged Mohamed Abd-Elhakim Barakat, Noha Ahmed El-Boghdady, Ebtehal Kamal Eldin Farrag, Ataa Abdelhalim Said and Sylvia Edward Shaker [] |
CNS?Neuroscience & Therapeutics | Negative regulation of glial Tim‐3 inhibits the secretion of inflammatory factors and modulates microglia to antiinflammatory phenotype after experimental intracerebral?… [Pubmed: 30677253] |
International immunopharmacology | NADPH oxidase 2-mediated NLRP1 inflammasome activation involves in neuronal senescence in hippocampal neurons in vitro [Pubmed: 30677569] |
博士論文 | INSTITUTO DE CIENCIAS BáSICAS Y PRECLíNICAS “VICTORIA DE GIRóN” DEPARTAMENTO DE HISTOLOGíA [] |
Life Sciences | Rosmarinic acid attenuates inflammatory responses through inhibiting HMGB1/TLR4/NF-κB signaling pathway in a mouse model of Parkinson's disease [] |
Cellular?and Molecular Neurobiology | Microglia-Derived Adiposomes are Potential Targets for the Treatment of Ischemic Stroke [Pubmed: 30852719] |
Royal?Society?Open?Science | Metabolomics analysis of baicalin on ovalbumin-sensitized allergic rhinitis rats [] |
博士論文 | 6. Manuscript II: Evaluation of IL-1β levels in epilepsy and traumatic brain injury in dogs [] |
Experimental?Biology?and?Medicine | Grape seed proanthocyanidin extract alleviates arsenic-induced lung damage through NF-κB signaling [Pubmed: 30869553] |
Journal of Biological Sciences | Protective and Curative Effects of Bombax ceiba Flower and Ziziphus spina christi Fruit Extracts on Gastric Ulcer [] |
Journal of?Animal?Science | Adipose tissue proteomic analysis in ketotic or healthy Holstein cows in early lactation [Pubmed: 30985866] |
Journal of?Pineal?Research | Role of melatonin in sleep deprivation‐induced intestinal barrier dysfunction in mice [Pubmed: 30929267] |
Life?Sciences | 1, 25-(OH) 2D3 protects Schwann cells against advanced glycation end products-induced apoptosis through PKA-NF-κB pathway [Pubmed: 30928409] |
Toxicon | The wound healing potential of a pro-angiogenic peptide purified from Indian Russell's viper (Daboia russelii) venom [Pubmed: 31054289] |
Mucosal Immunology | Irf5 deficiency in myeloid cells prevents necrotizing enterocolitis by inhibiting M1 macrophage polarization [Pubmed: 31086271] |
The role of amniotic fluid exosome, hypoxia inducible fator-1α, and inflammatory cytokine in cervical insufficiency [] | |
pharmacological research | Neuroprotection in non-transgenic and transgenic mouse models of Alzheimer's disease by positive modulation of σ1 receptors [Pubmed: 31048034] |
Stem Cell Reviews and Reports | The Nlrp3 Inflammasome Orchestrates Mobilization of Bone Marrow-Residing Stem Cells into Peripheral Blood [Pubmed: 31089880] |
IUBMB Life | Melatonin Enhances Autophagy and Decreases Apoptosis Induced by nanosilica in RAW264. 7 cells [Pubmed: 31018046] |
Phytotherapy Research | Total flavonoids from sea buckthorn ameliorates lipopolysaccharide/cigarette smoke‐induced airway inflammation [Pubmed: 31209984] |
American Journal of Reproductive Immunology | Effect of alpha lipoic acid and myoinositol on endometrial inflammasome from recurrent pregnancy loss women [Pubmed: 31148259] |
BMC NEUROSCIENCE | Evaluation of IL-1β levels in epilepsy and traumatic brain injury in dogs [Pubmed: 31208341] |
Pharmacological Research | Ethanol extracts of Danlou tablet attenuate atherosclerosis via inhibiting inflammation and promoting lipid effluent [Pubmed: 31181336] |
Frontiers in Immunology | Expression and Purification of Hybrid LL-37Tα1 Peptide in Pichia pastoris and evaluation of their Immunomodulatory and anti-inflammatory activities by LPS?… [] |
Food & Function | Network pharmacology oriented study reveals inflammatory state-dependent dietary supplement hepatotoxicity responses in normal and diseased rats [Pubmed: 31140472] |
Journal of the Royal Army Medical Corps | CD28 deficiency attenuates primary blast-induced renal injury in mice via the PI3K/Akt signalling pathway [Pubmed: 31129646] |
Metallomics | Lanthanum chloride induces neuron damage by activating the nuclear factor-kappa B signaling pathway in activated microglia [Pubmed: 31187842] |
Pinealektomize Edilmi? Septik S??anlarda TNF-α, IL-6, IL-10 ve IL-1β'nin Kan Düzeyleri ile Karaci?er ve B?brekte Gen Ekspresyonu Seviyelerindeki?… [Doi: 10.5505/vtd.2019.32815] | |
Journal of Neurochemistry | Crosstalk between Cdk5/p35 and ERK1/2 signalling mediates spinal astrocyte activity via the PPARγ pathway in a rat model of chronic constriction injury [Pubmed: 31314915] |
Nature Chemical Biology | S-glycosylation-based cysteine profiling reveals regulation of glycolysis by itaconate [Pubmed: 31332308] |
neuroscience letters | Madecassoside ameliorates lipopolysaccharide-induced neurotoxicity in rats by activating the Nrf2-HO-1 pathway [Pubmed: 31330225] |
Free Radical Biology and Medicine | Vitamin D protects against oxidative stress, inflammation and hepatorenal damage induced by acute paracetamol toxicity in rat [Pubmed: 31255668] |
Nanomedicine | Antihyperuricemic and anti-gouty arthritis activities of Aurantii fructus immaturus carbonisata-derived carbon dots [Pubmed: 31418646] |
Food & Function | A dietary polysaccharide from Eucheuma cottonii downregulates proinflammatory cytokines and ameliorates osteoarthritis-associated cartilage degradation in obese?… [] |
Inflammopharmacology | Betulinic acid attenuates lipopolysaccharide-induced vascular hyporeactivity in the rat aorta by modulating Nrf2 antioxidative function [Pubmed: 31352642] |
Phytomedicine | Novel evidence that an alternative complement cascade pathway is involved in optimal mobilization of hematopoietic stem/progenitor cells in Nlrp3?… [] |
Int Immunopharmacol | Metallothionein-1 is associated with osteoarthritis disease activity and suppresses proinflammatory cytokines production in synovial cells [Pubmed: 31465913] |
Animals | Anti-Inflammatory State in Arabian Horses Introduced to the Endurance Training [Pubmed: 31462005] |
Frontiers in Pharmacology | Naoxintong Capsule Inhibits the Development of Cardiovascular Pathological Changes in Bama Minipig Through Improving Gut Microbiota [Pubmed: 31632272] |
International Journal of Molecular Sciences | Cichorium intybus L. Extract Suppresses Experimental Gout by Inhibiting the NF-κB and NLRP3 Signaling Pathways [Pubmed: 31590257] |
Scientific Reports | Anti-inflammatory and antioxidant effects of muscarinic acetylcholine receptor (mAChR) activation in the rat hippocampus [Pubmed: 31578381] |
Journal of Medicinal Food | Polysaccharide from the Seeds of Plantago asiatica L. Protect Against Lipopolysaccharide-Induced Liver Injury [Pubmed: 31560611] |
Molecular Medicine Reports | High?fat treatment prevents postoperative cognitive dysfunction in a hyperlipidemia model by protecting the blood?brain barrier via Mfsd2a?related signaling [Pubmed: 31545471] |
Antioxidants | Oxidative Stress, NF-κB-Mediated Inflammation and Apoptosis in the Testes of Streptozotocin–Induced Diabetic Rats: Combined Protective Effects of Malaysian?… [Pubmed: 31600920] |
LIFE SCIENCES | Protective effects of epigallocatechin gallate against ischemia reperfusion injury in rat skeletal muscle via activating Nrf2/HO-1 signaling pathway [Pubmed: 31678278] |
BMC Complementary and Alternative Medicine | Qingkailing injection ameliorates cerebral ischemia-reperfusion injury and modulates the AMPK/NLRP3 Inflammasome Signalling pathway [Pubmed: 31747940] |
life sciences | Melatonin biosynthesis restored by CpG oligodeoxynucleotides attenuates allergic airway inflammation via regulating NLRP3 inflammasome [Pubmed: 31738882] |
international journal of molecular sciences | Anti-Inflammatory and Anti-Apoptotic Effects of Stybenpropol A on Human Umbilical Vein Endothelial Cells [Pubmed: 31671764] |
Journal of Controlled Release | Ginsenoside Rg3-loaded, reactive oxygen species-responsive polymeric nanoparticles for alleviating myocardial ischemia-reperfusion injury [Pubmed: 31783047] |
Journal of Food Science | Effects of Total Flavonoids from Exocarpium Citri Grandis on Air Pollution Particle‐Induced Pulmonary Inflammation and Oxidative Stress in Mice [Pubmed: 31762039] |
Cytokine | Levels of pro-and anti-inflammatory cytokines in cystic fibrosis patients with or without gingivitis [Pubmed: 31927460] |
Journal of?Photochemistry and?Photobiology?B | Neuroprotective effect of Wogonin on Rat's brain exposed to gamma irradiation [Pubmed: 31935591] |
Archives of Biochemistry and Biophysics | Syringin protects against colitis by ameliorating inflammation [Pubmed: 31899146] |
International Journal of Molecular Sciences | Pistachio Consumption Alleviates Inflammation and Improves Gut Microbiota Composition in Mice Fed a High-Fat Diet [Pubmed: 31935892] |
Pharmacology Biochemistry and Behavior | Duloxetine reverses the symptoms of overactive bladder co-existing with depression via the central pathways [Pubmed: 31899220] |
Frontiers in Immunology | The Increase in IL-1β in the Early Stage of Heatstroke Might Be Caused by Splenic Lymphocyte Pyroptosis Induced by mtROS-Mediated Activation of the?… [Pubmed: 31921131] |
Nutrients | Rotundic Acid Protects against Metabolic Disturbance and Improves Gut Microbiota in Type 2 Diabetes Rats [Pubmed: 31887996] |
GENES TO CELLS | MiR‐29c‐3p inhibits microglial NLRP3 inflammasome activation by targeting NFAT5 in Parkinson's disease [Pubmed: 32160394] |
Nanomedicine | The toxicity of alumina nanoparticles to immune system in mice [Pubmed: 32162999] |
Frontiers in Pharmacology | Toddalolactone Protects Lipopolysaccharide-Induced Sepsis and Attenuates Lipopolysaccharide-Induced Inflammatory Response by Modulating HMGB1-NF … [Pubmed: 32153412] |
Endocrine | Glucagon-like peptide-2 analog and inflammatory state in obese mice [Pubmed: 32172484] |
Biomed Pharmacother | Suppression of Fpr2 expression protects against endotoxin-induced acute lung injury by interacting with Nrf2-regulated TAK1 activation [Pubmed: 32106380] |
BRAIN BEHAVIOR AND IMMUNITY | AVNP2 protects against cognitive impairments induced by C6 glioma by suppressing tumour associated inflammation in rats [Pubmed: 32097763] |
Frontiers in Microbiology | Topical Therapeutic Efficacy of Ebselen Against Multidrug-Resistant Staphylococcus aureus LT-1 Targeting Thioredoxin Reductase [Pubmed: 32010088] |
Biomed Pharmacother | Deletion of macrophage migration inhibitory factor ameliorates inflammation in mice model severe acute pancreatitis [Pubmed: 32062385] |
Frontiers in Immunology | TLR2-Melatonin Feedback Loop Regulates the Activation of NLRP3 Inflammasome in Murine Allergic Airway Inflammation [Pubmed: 32117301] |
JOURNAL OF HAZARDOUS MATERIALS | Silica nanoparticles induce JNK-mediated inflammation and myocardial contractile dysfunction [Pubmed: 32036317] |
Biomed Research International | Hydrogen-Rich Saline Inhibits Lipopolysaccharide-Induced Acute Lung Injury and Endothelial Dysfunction by Regulating Autophagy through mTOR/TFEB … [Pubmed: 32071922] |
Epilepsy Behav | Metformin and trimetazidine ameliorate diabetes-induced cognitive impediment in status epileptic rats [Pubmed: 32000097] |
Archives of Biochemistry and Biophysics | Micro RNA 146a gene variant/TNF-α/IL-6/IL-1 β; A cross-link axis inbetween oxidative stress, endothelial dysfunction and neuro-inflammation in acute ischemic stroke … [Pubmed: 31738890] |
Oxidative Medicine and Cellular Longevity | Dexmedetomidine Attenuates Orthotopic Liver Transplantation-Induced Acute Gut Injury via α2-Adrenergic Receptor-Dependent Suppression of Oxidative Stress [Pubmed: 31827710] |
Medical Science Monitor | MicroRNA-27a-3p Downregulation Inhibits Inflammatory Response and Hippocampal Neuronal Cell Apoptosis by Upregulating Mitogen-Activated Protein Kinase 4?… [Pubmed: 31710596] |
Molecular Therapy - Nucleic Acids | Systematic transcriptome and regulatory network analyses reveal the hypoglycemic mechanism of Dendrobium fimbriatum [Pubmed: 31790971] |
Chinese Journal of Natural Medicines | Shenfu injection attenuates lipopolysaccharide-induced myocardial inflammation and apoptosis in rats [Pubmed: 32245593] |
International Journal of Molecular Medicine | Ligustrazine ameliorates lipopolysaccharide?induced neurocognitive impairment by activating autophagy via the PI3K/AKT/mTOR pathway [Pubmed: 32236586] |
Journal of Pharmacy and Pharmacology | Tectorigenin inhibits inflammation and pulmonary fibrosis in allergic asthma model of ovalbumin‐sensitized guinea pigs [Pubmed: 32314371] |
veterinary research | Newcastle disease virus RNA-induced IL-1β expression via the NLRP3/caspase-1 inflammasome [Pubmed: 32293543] |
molecular immunology | STAT5a induces endotoxin tolerance by alleviating pyroptosis in kupffer cells [Pubmed: 32298872] |
journal of dairy science | Mitochondrial membrane protein mitofusin 2 as a potential therapeutic target for treating free fatty acid–induced hepatic inflammation in dairy cows during early?… [Pubmed: 32278565] |
Inflammation | Cyanidin-3-O-Glucoside Attenuates Lipopolysaccharide-Induced Inflammation in Human Corneal Epithelial Cells by Inducing Let-7b-5p-Mediated HMGA2/PI3K/Akt?… [Pubmed: 32248330] |
Pharmazie | Anti-inflammatory effects of ginsenoside Rg3 on the hypertrophic scar formation via the NF-κB/IκB signaling pathway in rabbit ears [Pubmed: 32213242] |
Marine Drugs | Tu-Teng-Cao Extract Alleviates Monosodium Urate-Induced Acute Gouty Arthritis in Rats by Inhibiting Uric Acid and Inflammation [Pubmed: 23306170] |
Nanomaterials | An OMV-Based Nanovaccine Confers Safety and Protection against Pathogenic Escherichia coli via Both Humoral and Predominantly Th1 Immune Responses in?… [Pubmed: 33233490] |
LIFE SCIENCES | Intravitreal conbercept improves outcome of proliferative diabetic retinopathy through inhibiting inflammation and oxidative stress [Pubmed: 33227274] |
VETERINARY MICROBIOLOGY | Upregulation of HMGB1 Secretion in Lungs of Pigs Infected by Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus [Pubmed: 33221069] |
Exp Lung Res | Ketogenic diet induces autophagy to alleviate bleomycin-induced pulmonary fibrosis in murine models [Pubmed: 33121292] |
BIOMEDICINE & PHARMACOTHERAPY | The influence of Potentilla chinensis aqueous extract on urinary bladder function in retinyl acetate-induced detrusor overactivity in rats [Pubmed: 33113423] |
Cell Biochem Funct | The role of Smad4 in the regulation of insulin resistance, inflammation and cell proliferation in HTR8‐Svneo cells [Pubmed: 33079408] |
Neuroscience | A new therapeutic strategy targeting protein deacetylation for spinal cord injury [Pubmed: 33039524] |
J Diabetes | Integrative analysis of hepatic metabolomic and transcriptomic data reveals potential mechanism of non‐alcoholic steatohepatitis in high‐fat diet‐fed mice [Pubmed: 33022884] |
BIOMEDICINE & PHARMACOTHERAPY | Chlorogenic acid prevents acute myocardial infarction in rats by reducing inflammatory damage and oxidative stress [Pubmed: 33022535] |
DRUG AND CHEMICAL TOXICOLOGY | Toxicological impact of sodium benzoate on inflammatory cytokines, oxidative stress and biochemical markers in male Wistar rats [Pubmed: 33003960] |
Antioxidants | Involvement of HO-1 and Autophagy in the Protective Effect of Magnolol in Hepatic Steatosis-Induced NLRP3 Inflammasome Activation In Vivo and In Vitro [Pubmed: 32992548] |
Autophagy | LDHB inhibition induces mitophagy and facilitates the progression of CSFV infection [Pubmed: 32924761] |
J Cell Mol Med | LIGHT aggravates sepsis‐associated acute kidney injury via TLR4‐MyD88‐NF‐κB pathway [Pubmed: 32881263] |
Nanotoxicology | miR-205/IRAK2 signaling pathway is associated with urban airborne PM2.5-induced myocardial toxicity [Pubmed: 32880512] |
Drug Design Development and Therapy | Exosomes Derived from MicroRNA-146a-5p-Enriched Bone Marrow Mesenchymal Stem Cells Alleviate Intracerebral Hemorrhage by Inhibiting Neuronal?… [Pubmed: 32821084] |
Biochimie | Exosomes derived from TSG-6 modified mesenchymal stromal cells attenuate scar formation during wound healing [Pubmed: 32800897] |
INVESTIGATIONAL NEW DRUGS | Dual-function chimeric antigen receptor T cells targeting c-Met and PD-1 exhibit potent anti-tumor efficacy in solid tumors [Pubmed: 32772342] |
Peptides | Liraglutide ameliorates lipotoxicity-induced inflammation through the mTORC1 signalling pathway [Pubmed: 32771373] |
Scientific Reports | Beneficial effects of manually assisted chiropractic adjusting instrument in a rabbit model of osteoarthritis [Pubmed: 32764579] |
Journal of Natural Medicines | Preventive effect of dioscin against monosodium urate-mediated gouty arthritis through inhibiting inflammasome NLRP3 and TLR4/NF-κB signaling pathway activation?… [Pubmed: 32761488] |
MOLECULAR AND CELLULAR BIOCHEMISTRY | MicroRNA-217 ameliorates inflammatory damage of endothelial cells induced by oxidized LDL by targeting EGR1 [Pubmed: 32737769] |
Int Immunopharmacol | BNIP3 deletion ameliorated enterovirus 71 infection-induced hand, foot and mouth disease via inhibiting apoptosis, autophagy, and inflammation in mice [Pubmed: 32717566] |
BRAIN BEHAVIOR AND IMMUNITY | Active smoking, sleep quality and cerebrospinal fluid biomarkers of neuroinflammation [Pubmed: 32717405] |
molecular immunology | TLR9 mediates the activation of NLRP3 inflammasome and oxidative stress in murine allergic airway inflammation [Pubmed: 32623292] |
Scientific Reports | Integrated metabolomics and gut microbiome to the effects and mechanisms of naoxintong capsule on type 2 diabetes in rats [Pubmed: 32616735] |
european journal of pharmacology | The effect of O-1602, a GPR55 agonist, on the cyclophosphamide-induced rat hemorrhagic cystitis [Pubmed: 32615180] |
Frontiers in Bioengineering and Biotechnology | In vitro Impact of Yeast Expressed Hybrid Peptide CATH-2TP5 as a Prophylactic Measure Toward Sepsis and Inflammation [Pubmed: 32582649] |
Journal of Neuroinflammation | CX3CR1-microglia mediates neuroinflammation and blood pressure regulation in the nucleus tractus solitarii of fructose-induced hypertensive rats [Pubmed: 32532282] |
Frontiers in Pharmacology | Oxymatrine Attenuates Dopaminergic Neuronal Damage and Microglia-Mediated Neuroinflammation Through Cathepsin D-Dependent HMGB1/TLR4/NF-κB … [Pubmed: 32528295] |
Life Sci | Puerarin ameliorates retinal ganglion cell damage induced by retinal ischemia/reperfusion through inhibiting the activation of TLR4/NLRP3 inflammasome [Pubmed: 32526286] |
Brain and Behavior | bFGF promotes neurological recovery from neonatal hypoxic–ischemic encephalopathy by IL‐1β signaling pathway‐mediated axon regeneration [Pubmed: 32525289] |
American Journal of Translational Research | Inhibition of calpain alleviates coxsackievirus B3-induced myocarditis through suppressing the canonical NLRP3 inflammasome/caspase-1-mediated and … [Pubmed: 32509190] |
Frontiers in Pharmacology | Hyperoside Protects Human Umbilical Vein Endothelial Cells Against Anticardiolipin Antibody-Induced Injury by Activating Autophagy [Pubmed: 32508661] |
Clinical Oral Investigations | Bone microRNA-21 as surgical stress parameter is associated with third molar postoperative discomfort [Pubmed: 32495225] |
STEM CELL REVIEWS AND REPORTS | A Novel Evidence That Mannan Binding Lectin (MBL) Pathway of Complement Cascade Activation is Involved in Homing and Engraftment of Hematopoietic Stem … [Pubmed: 32406006] |
Int J Mol Sci | Effects of PDE3 Inhibitor Olprinone on the Respiratory Parameters, Inflammation, and Apoptosis in an Experimental Model of Acute Respiratory Distress Syndrome [Pubmed: 32403267] |
Int Immunopharmacol | Celastrol attenuates collagen-induced arthritis via inhibiting oxidative stress in rats [Pubmed: 32402948] |
Molecular Biology Reports | The effect of subacute poisoning with fenpropathrin on mice kidney function and the level of interleukin 1β and tumor necrosis factor α. [Pubmed: 32385770] |
european journal of pharmaceutical sciences | Stimulation of atypical cannabinoid receptor GPR55 abolishes the symptoms of detrusor overactivity in spontaneously hypertensive rats [Pubmed: 32360768] |
BIOSCIENCE REPORTS | IL-38 restrains inflammatory response of collagen-induced arthritis in rats via SIRT1/HIF-1α signaling pathway [Pubmed: 32347300] |
BIOMEDICINE & PHARMACOTHERAPY | Protective effects of bee bread on testicular oxidative stress, NF-κB-mediated inflammation, apoptosis and lactate transport decline in obese male rats [Pubmed: 33152939] |
ACS Chemical Neuroscience | α-Synuclein Exhibits Differential Membrane Perturbation, Nucleation, and TLR2 Binding through Its Secondary Structure [Pubmed: 33196165] |
Nutrition | Changes in peripheral inflammation-related gene expression by postprandial glycemic response in healthy Japanese men [Pubmed: 33131984] |
Journal of Diabetes Research | Regulation and Mechanism of miR-518d through the PPARα-Mediated NF-κB Pathway in the Development of Gestational Diabetes Mellitus [Pubmed: 33123597] |
International Immunopharmacology | Echinacea polysaccharide alleviates LPS-induced lung injury via inhibiting inflammation, apoptosis and activation of the TLR4/NF-κB signal pathway [Pubmed: 33182056] |
Biomedicine & Pharmacotherapy | Cepharanthine attenuates cerebral ischemia/reperfusion injury by reducing NLRP3 inflammasome-induced inflammation and oxidative stress via inhibiting 12?… [Pubmed: 32559840] |
European Review for Medical and Pharmacological Sciences | Neuroprotective effect of CTRP3 overexpression against sevoflurane anesthesia-induced cognitive dysfunction in aged rats through activating AMPK/SIRT1 and … [Pubmed: 32432773] |
Domestic Animal Endocrinology | A Preliminary Evaluation of the Circulating Leptin/Adiponectin Ratio in Dogs with Pituitary-Dependent Hyperadrenocorticism and concurrent diabetes mellitus [Pubmed: 32920447] |
Biomedicine & Pharmacotherapy | Qingfei oral liquid alleviates airway hyperresponsiveness and mucus hypersecretion via TRPV1 signaling in RSV-infected asthmatic mice [Pubmed: 32521453] |
International Journal of Nanomedicine | Effect of Lonicerae japonicae Flos Carbonisata-Derived Carbon Dots on Rat Models of Fever and Hypothermia Induced by Lipopolysaccharide [Pubmed: 32606669] |
Frontiers in Pharmacology | O-1602, an Agonist of Atypical Cannabinoid Receptors GPR55, Reverses the Symptoms of Depression and Detrusor Overactivity in Rats Subjected to?… [Pubmed: 32733244] |
Inflammation | Tetramethylpyrazine Inhibits Platelet Adhesion and Inflammatory Response in Vascular Endothelial Cells by Inhibiting P38 MAPK and NF-κB Signaling Pathways [] |
Indian Journal of Animal Sciences | Peripheral concentrations of metabolic and inflammatory indicators during transition period and their relationship with postpartum clinical endometritis in dairy?… [] |
Food & Function | Nicotinamide riboside alleviates alcohol-induced depression-like behaviours in C57BL/6J mice by altering the intestinal microbiota associated with microglial?… [] |
Food and Agricultural Immunology | Acrylamide induced the activation of NLRP3 inflammasome via ROS-MAPKs pathways in Kupffer cells [] |
Nanoscale Research Letters | Protective Effects of Carbon Dots Derived from Phellodendri Chinensis Cortex Carbonisata against Deinagkistrodon acutus Venom-Induced Acute Kidney?… [] |
Journal of Biochemical and Molecular Toxicology | Vitamin D3 and calcium cosupplementation alleviates cadmium hepatotoxicity in the rat: Enhanced antioxidative and anti‐inflammatory actions by remodeling cellular?… [] |
Biotechnology & Biotechnological Equipment | Honokiol inhibits inflammation and endoplasmic reticulum stress in a rat model of pregnancy-induced hypertension [] |
Journal of Functional Foods | Wine pomace product modulates oxidative stress and microbiota in obesity high-fat diet-fed rats [] |
Journal of Functional Foods | Polyphenolic extracts from Wushan tea leaves attenuate hepatic injury in CCl4-treated mice [] |
Microbiome changes in patients with chronic heart failure with preserved ejection fraction correlate with fibrosis markers: Description of a Russian cohort [] | |
Iranian Journal of Allergy, Asthma and Immunology | Increased Level of Caspase-1 in the Serum of Relapsing-remitting Multiple Sclerosis (RRMS) Patients [] |
Interferon regulatory factor 8 induces alveolar macrophage hypoxia/reoxygenation injury via the PINK1/Parkin mitophagy pathway [] | |
Phytomedicine | Menthacarin attenuates experimental colitis [] |
ACS Biomaterials Science & Engineering | Tissue-Engineered Decellularized Allografts for Anterior Cruciate Ligament Reconstruction [] |
The Role of Inflammatory Cytokine and Inflammatory Regulator Protein Related to Severity of Joint Effusion in Osteoarthritis [] | |
Tempuyung Leaves (Sonchus arvensis) Ameliorates Monosodium Urate Crystal-Induced Gouty Arthritis in Rats through Anti-Inflammatory Effects [] | |
Overektomize di?i s??anlarda beyin oksidatif stres, bdnf ve inflamatuar cevap düzeyleri ile n?rodavran??sal de?i?iklikler üzerine anjiyotensin II ?nhibisyonunun etkisi [] | |
Drug Dev Res | Paeoniflorin inhibited nod?\like receptor protein?\3 inflammasome and NF?\|êB?\mediated inflammatory reactions in diabetic foot ulcer by inhibiting the chemokine??- [33236457] |
Respir Physiol Neurobiol | Protective effect of Toll-interacting protein overexpression against paraquat-induced lung injury in mice and A549 cells through inhibiting oxidative stress??- [33333238] |
Scientific Reports | Immunogenicity and protective efficacy of enterotoxigenic Escherichia coli (ETEC) total RNA against ETEC challenge in a mouse model [33239756] |
Nutrients | AphaMax?, an Aphanizomenon Flos-Aquae Aqueous Extract, Exerts Intestinal Protective Effects in Experimental Colitis in Rats [33256017] |
Bull Exp Biol Med | Inflammation Mediators Regulate the Microbiota Resistance to Adverse Factors [33222085] |
Int J Mol Med | Astragaloside IV alleviates silica?induced pulmonary fibrosis via inactivation of the TGF?|?1/Smad2/3 signaling pathway [33448318] |
Biochem Pharmacol | Inactivation of Wnt/|?-catenin/renin angiotensin axis by tumor necrosis factor-alpha inhibitor, infliximab, ameliorates CKD induced in rats [33482150] |
Stem Cell Reviews and Reports | Prospects on the Potential In Vitro Regenerative Features of Mechanically Treated-Adipose Tissue for Osteoarthritis Care [33469783] |
EUROPEAN JOURNAL OF PHARMACOLOGY | Gliclazide alters macrophages polarization state in diabetic atherosclerosis in vitro via blocking AGE-RAGE/TLR4-reactive oxygen species-activated NF-k|? nexus [33460615] |
Molecules | Alpha-Lipoic Acid Plays a Role in Endometriosis: New Evidence on Inflammasome-Mediated Interleukin Production, Cellular Adhesion and Invasion [33430011] |
MEDIATORS OF INFLAMMATION | MMP-9 Concentration in Peritoneal Fluid Is a Valuable Biomarker Associated with Endotoxemia in Equine Colic [33488296] |
Mol Cell Biochem | Intermittent high glucose induces pyroptosis of rat H9C2 cardiomyocytes via sodium¨Cglucose cotransporter 1 [33608832] |
Life Sci | Celecoxib ameliorates liver cirrhosis via reducing inflammation and oxidative stress along spleen-liver axis in rats [33577848] |
Life Sci | Inhibition of SGLT1 protects against glycemic variability-induced cardiac damage and pyroptosis of cardiomyocytes in diabetic mice [33508297] |
Animal | Effect of alfalfa hay and starter feed supplementation on caecal microbiota and fermentation, growth, and health of yak calves [33610512] |
european journal of clinical nutrition? | Effect of Lactobacillus casei on lipid metabolism and intestinal microflora in patients with alcoholic liver injury [33514869] |
Int Immunopharmacol | Ginkgolide A attenuates sepsis-associated kidney damage via upregulating microRNA-25 with NADPH oxidase 4 as the target [33677255] |
Tissue Cell | Protective effects of Oridonin against cerebral ischemia/reperfusion injury by inhibiting the NLRP3 inflammasome activation [33676236] |
bmc pediatrics | Factors associated with neurodevelopment in preterm infants with systematic inflammation [33685414] |
INFLAMMATION | Acid Sphingomyelinase and Acid |?-Glucosidase 1 Exert Opposite Effects on Interleukin-1|?-Induced Interleukin 6 Production in Rheumatoid Arthritis Fibroblast-Like Synoviocytes [33665756] |
JOURNAL OF PERIODONTAL RESEARCH | Potential biomarkers reflecting inflammation in patients with severe periodontitis: Fractalkine (CX3CL1) and its receptor (CX3CR1) [33641164] |
Biochem Cell Biol | Formononetin protects against concanavalin-A-induced autoimmune hepatitis in mice through its anti-apoptotic and anti-inflammatory properties [33749318] |
J Physiol Biochem | Autophagy blockage promotes the pyroptosis of ox-LDL-treated macrophages by modulating the p62/Nrf2/ARE axis [33886081] |
Hum Exp Toxicol | Alamandine significantly reduces doxorubicin-induced cardiotoxicity in rats [33882726] |
NEUROSCIENCE RESEARCH | Sleep disturbance induces depressive behaviors and neuroinflammation by altering the circadian oscillations of clock genes in rats [33785408] |
FASEB Bioadv | Cyclophilin A induces macrophage apoptosis and enhances atherosclerotic lesions in high?\fat diet?\fed hyperglycemic rabbits [33977232] |
Arch Biochem Biophys | Vitamin D ameliorates high-fat-diet-induced hepatic injury via inhibiting pyroptosis and alters gut microbiota in rats [33965368] |
Randomized Controlled Trial | Effect of Freeze-Dried Amnion Graft on Cytokines in Uterine Exudates Following Hysteroscopic Adhesiolysis of Severe Intrauterine Adhesions [28170094] |
Orthop Surg | Proline?\Serine¨CThreonine Phosphatase?\Interacting Protein 2 Alleviates Diabetes Mellitus?\Osteoarthritis in Rats through Attenuating Synovial Inflammation and??- [33939302] |
Biomed Pharmacother | Captopril downregulates expression of Bax/cytochrome C/caspase-3 apoptotic pathway, reduces inflammation, and oxidative stress in cisplatin-induced acute??- [33945910] |
PLoS One | Beneficial impact of cathelicidin on hypersensitivity pneumonitis treatment?aIn vivo studies [33999928] |
Nephron | Dexmedetomidine Exerts Renal Protective Effect by Regulating the PGC-1|á/STAT1/IRF-1 Axis [33965939] |
Stem Cell Research & Therapy | Consecutive daily administration of intratracheal surfactant and human umbilical cord-derived mesenchymal stem cells attenuates hyperoxia-induced lung??- [33933128] |
BMC Pharmacology & Toxicology | Subacute poisoning with bifenthrin increases the level of interleukin 1? in mice kidneys and livers [33902677] |
Clin Oral Investig | Evaluation of heat shock protein 70 and toll-like receptor 4 expression in gingival crevicular fluid in response to orthodontic forces [34091792] |
Placenta | Vitamin D alleviates hypoxia/reoxygenation-induced injury of human trophoblast HTR-8 cells by activating autophagy [34126416] |
Chem Biol Interact | Hepatoprotective effect of anemoside B4 against sepsis-induced acute liver injury through modulating the mTOR/p70S6K-mediated autophagy [34051206] |
Med Sci Monit | Post-Treatment Sevoflurane Protects Against Hypoxic-Ischemic Brain Injury in Neonatal Rats by Downregulating Histone Methyltransferase G9a and Upregulating ?- [34059615] |
Exp Eye Res | Topical calcitriol application promotes diabetic corneal wound healing and reinnervation through inhibiting NLRP3 inflammasome activation [34144035] |
BioMed Research International | Ultrashort Wave Combined with Human Umbilical Cord Mesenchymal Stem Cell (HUC-MSC) Transplantation Inhibits NLRP3 Inflammasome and Improves??- [33376718] |
Evidence-Based Complementary and Alternative Medicine | Zisheng Shenqi Decoction Ameliorates Monosodium Urate-Mediated Gouty Arthritis in Rats via Promotion of Autophagy through the AMPK/mTOR Signaling??- [33505502] |
Basic and Clinical Neuroscience | Paeonol Protects Against Intrastriatal 6-Hydroxydopamine Rat Model of Parkinson's Disease [33995926] |
BioMed Research International | MiR-599 Protects Cardiomyocytes against Oxidative Stress-Induced Pyroptosis [33681353] |
cells | The Effect of the Clenbuterol?a|?2-Adrenergic Receptor Agonist on the Peripheral Blood Mononuclear Cells Proliferation, Phenotype, Functions, and Reactive Oxygen??- [33920705] |
Antioxidants | Hidrox? Roles in Neuroprotection: Biochemical Links between Traumatic Brain Injury and Alzheimer's Disease [34065584] |
Melatonin-mediated MT2 attenuates colitis induced by dextran sodium sulfate via PI3K/AKT/Nrf2/SIRT1/ROR|á/NF-|êB signaling pathways [34162146] | |
Natural Product Communications | Oral Administration of Salmon Cartilage Proteoglycan Attenuates Osteoarthritis in a Monosodium Iodoacetate-Induced Rat Model [] |
Journal of Alzheimer's disease | DAla2-GIP-GLU-PAL Protects Against Cognitive Deficits and Pathology in APP/PS1 Mice by Inhibiting Neuroinflammation and Up-regulating cAMP/PKA/CREB??- [] |
researchsquare | p62 promotes HIV-1 gp120 V3 loop-mediated microglial inflammation by promoting noncanonical activation of Nrf2 [] |
Berberine Attenuates Neonatal Sepsis in Rats By Inhibiting FOXA1 and NF-|êB Signaling Transduction Via The Induction of miR-132-3p [] | |
biomolecules | Treadmill Running Changes Endothelial Lipase Expression: Insights from Gene and Protein Analysis in Various Striated Muscle Tissues and Serum [] |
Antioxidants | Oxidative Stress Mediates Vascular Tortuosity [] |
Peptides | Angiotensin-(1-7) protects against sepsis-associated left ventricular dysfunction induced by lipopolysaccharide [34298021] |
Cancer Lett | Photodynamic therapy induces human esophageal carcinoma cell pyroptosis by targeting the PKM2/caspase-8/caspase-3/GSDME axis [34256094] |
J Pharm Pharmacol | Alamandine protects against renal ischaemia–reperfusion injury in rats via inhibiting oxidative stress [34244746] |
Food Chem Toxicol | GR-mediated anti-inflammation of α-boswellic acid: Insights from in vitro and in silico studies [34197882] |
Front Pharmacol | In Silico and In Vivo Studies on the Mechanisms of Chinese Medicine Formula (Gegen Qinlian Decoction) in the Treatment of Ulcerative Colitis [34177580] |
J Cell Mol Med | Puerarin attenuates intracerebral hemorrhage‐induced early brain injury possibly by PI3K/Akt signal activation‐mediated suppression of NF‐κB pathway [34180121] |
Aging | Yiqi Jiemin decoction alleviates allergic rhinitis in a guinea pig model by suppressing inflammation, restoring Th1/Th2 balance, and improving cellular?… [34315133] |
Peptides | Alamandine, a derivative of angiotensin-(1-7), alleviates sepsis-associated renal inflammation and apoptosis by inhibiting the PI3K/Ak and MAPK pathways [34400214] |
J Neuroinflammation | Inhibition of heat shock protein family A member 8 attenuates spinal cord ischemia–reperfusion injury via astrocyte NF-κB/NLRP3 inflammasome pathway [34362408] |
Medicine (Baltimore) | Clinical value of CD97 and CD55 levels in the differential diagnosis of tuberculous and malignant pleural effusions [34397724] |
Mol Med Rep | Sacubitril/valsartan (LCZ696) reduces myocardial injury following myocardial infarction by inhibiting NLRP3?induced pyroptosis via the TAK1/JNK signaling pathway [34296299] |
J Asthma | Clinical and Biological Indicators of Periodontal Disease in Obese and non-Obese adults with and without Bronchial Asthma [34324826] |
Int Immunopharmacol | The protective effect of isoflurane pretreatment on liver IRI by suppressing noncanonical pyroptosis of liver macrophages [34332342] |
Inflammation | Berberine Attenuates Neonatal Sepsis in Mice By Inhibiting FOXA1 and NF-κB Signal Transduction Via the Induction of MiR-132-3p [34523052] |
Mol Med Rep | Emodin inhibits the progression of acute pancreatitis via regulation of lncRNA TUG1 and exosomal lncRNA TUG1 [34498715] |
Int Immunopharmacol | Pravastatin attenuates sepsis-induced acute lung injury through decreasing pulmonary microvascular permeability via inhibition of Cav-1/eNOS pathway [34464887] |
JOURNAL OF PHARMACY AND PHARMACOLOGY | Potential therapeutic efficacy of pachymic acid in chronic kidney disease induced in rats: role of Wnt/β-catenin/renin–angiotensin axis [34549301] |
ECOTOXICOLOGY AND ENVIRONMENTAL SAFETY | Chronic developmental exposure to low-dose ([C8mim][PF6]) induces neurotoxicity and behavioural abnormalities in rats [34555716] |
BIOMEDICINE & PHARMACOTHERAPY | Ginkgo biloba extract (EGb 761) mitigates methotrexate-induced testicular insult in rats: Targeting oxidative stress, energy deficit and spermatogenesis [34560547] |
Cell Metabolism | Pharmacological inhibition of arachidonate 12-lipoxygenase ameliorates myocardial ischemia-reperfusion injury in multiple species [34536344] |
Food Chem Toxicol | Anti-inflammatory action of betulin and its potential as a dissociated glucocorticoid receptor modulator [34500009] |
Neurosci Lett | Flavin-containing monooxygenase 1 deficiency promotes neuroinflammation in dopaminergic neurons in mice [34500002] |
Int J Biochem Cell Biol | Impact of Type 2 Diabetes Mellitus on the Immunoregulatory Characteristics of Adipose Tissue-Derived Mesenchymal Stem Cells [34455058] |
Int Immunopharmacol | Diacerein ameliorates testosterone-induced benign prostatic hyperplasia in rats: Effect on oxidative stress, inflammation and apoptosis [34450401] |
Biochim Biophys Acta Mol Cell Biol Lipids | Elaidic acid induced NLRP3 inflammasome activation via ERS-MAPK signaling pathways in Kupffer cells [34610469] |
CNS Neurosci Ther | Alterations in the gut microbiome with hemorrhagic transformation in experimental stroke [34591349] |
Med Pharm Rep | Effects of the Sonchus Arvensis Fraction in Rats with Monosodium Urate–Induced Gouty Arthritis [34430859] |
J Periodontol | Cytokine profile in serum and gingival crevicular fluid of children with inflammatory bowel disease: A case‐control study [34730850] |
J Agric Food Chem | Allicin Ameliorates Intestinal Barrier Damage via Microbiota-Regulated Short-Chain Fatty Acids-TLR4/MyD88/NF-κB Cascade Response in Acrylamide-Induced Rats [34694121] |
Inflammation | The Role of IL-27 in the Systemic Inflammatory Response That Accompanies Preterm Labour [34773188] |
Biofactors | Vitamin D3 enhances the effects of omega‐3 oils against metabolic dysfunction‐associated fatty liver disease in rat [34767670] |
Inflamm Res | Dexmedetomidine exerts cerebral protective effects against cerebral ischemic injury by promoting the polarization of M2 microglia via the Nrf2/HO-1/NLRP3 pathway [34767031] |
J Ethnopharmacol | Bai-Hu-Tang regulates endothelin-1 and its signalling pathway in vascular endothelial cells [34752899] |
Biomaterials | 3D-bioprinted BMSC-laden biomimetic multiphasic scaffolds for efficient repair of osteochondral defects in an osteoarthritic rat model [34739982] |
Korean J Physiol Pharmacol | Improved motility in the gastrointestinal tract of a postoperative ileus rat model with ilaprazole [34697261] |
Neurosci Let | Fingolimod protects against cerebral ischemia reperfusion injury in rats by reducing inflammatory cytokines and inhibiting the activation of p38 MAPK and NF-κB?… [34942319] |
Animals (Basel) | Inflammatory markers in uterine lavage fluids of pregnant, non-pregnant, and intrauterine device implanted mares on Days 10 and 15 post ovulation [34944269] |
Alzheimers Res Ther | Intermittent hypoxia treatment alleviates memory impairment in the 6-month-old APPswe/PS1dE9 mice and reduces amyloid beta accumulation and?… [34844651] |
World J Gastroenterol | Calycosin attenuates severe acute pancreatitis-associated acute lung injury by curtailing high mobility group box 1-induced inflammation [34908806] |
Experimental and Therapeutic Medicine | Autonomic regulation of imbalance?induced myocardial fibrosis and its mechanism in rats with cirrhosis [34373726] |
Food Science & Technology | Lactobacillus casei relieves liver injury by regulating immunity and suppression of the enterogenic endotoxin‐induced inflammatory response in rats cotreated with?… [34646510] |
Pharmaceutics | Nitric-Oxide-Releasing Dexamethasone Derivative NCX-1005 Improves Lung Function and Attenuates Inflammation in Experimental Lavage-Induced ARDS [34959373] |
Viruses | Interleukin-10-Mediated Lymphopenia Caused by Acute Infection with Foot-and-Mouth Disease Virus in Mice [34960627] |
Eur J Pharm Sci | Preclinical study of methotrexate-based hydrogels versus surfactant based liquid crystal systems on psoriasis treatment [34314841] |
Toxicology | Salidroside alleviates liver inflammation in furan-induced mice by regulating oxidative stress and endoplasmic reticulum stress [34450210] |
Animal Nutrition | Optimizing the growth and immune system of dairy calves by subdividing the pre-weaning period and providing different milk volumes for each stage [34786502] |
Antioxidants | Key Mechanisms and Potential Implications of Hericium erinaceus in NLRP3 Inflammasome Activation by Reactive Oxygen Species during Alzheimer's Disease [34829535] |
Mol Med Rep | Long non-coding RNA NEAT1 participates in ventilator-induced lung injury by regulating miR-20b expression [Pubmed:34981816] |
Anesthesiology | Adverse Mechanical Ventilation and Pneumococcal Pneumonia Induce Immune and Mitochondrial Dysfunctions Mitigated by Mesenchymal Stem Cells in Rabbits [Pubmed:34965287] |
J Mol Neurosci | TRPV1 Suppressed NLRP3 Through Regulating Autophagy in Microglia After Ischemia-Reperfusion Injury [Pubmed:35041191] |
J Inflamm Res | Clenbuterol, a Selective β2-Adrenergic Receptor Agonist, Inhibits or Limits Post-Stroke Pneumonia, but Increases Infarct Volume in MCAO Mice [Pubmed:35058704] |
Int J Nanomedicine | Protective Effects of Carbon Dots Derived from Armeniacae Semen Amarum Carbonisata Against Acute Lung Injury Induced by Lipopolysaccharides in Rats [Pubmed:35023915] |
Poult Sci | Hypervirulent FAdV-4 infection induces activation of the NLRP3 inflammasome in chicken macrophages [Pubmed:35077922] |
Animals (Basel) | Inflammatory Markers in Uterine Lavage Fluids of Pregnant, Non-Pregnant, and Intrauterine Device Implanted Mares on Days 10 and 15 Post Ovulation?… [Pubmed:34944269] |
Bioengineered | Inflammation promotes erythropoietin induced vascular calcification by activating p38 pathway [Pubmed:35168476] |
J Biochem Mol Toxicol | Silencing of IGF2BP1 restrains ox‐LDL‐induced lipid accumulation and inflammation by reducing RUNX1 expression and promoting autophagy in macrophages [Pubmed:35179253] |
Toxicology | NaF-induced neurotoxicity via activation of the IL-1β/JNK signaling pathway [Pubmed:35172196] |
Ecotoxicol Environ Saf | Silica nanoparticles induce pulmonary autophagy dysfunction and epithelial-to-mesenchymal transition via p62/NF-κB signaling pathway [Pubmed:35158278] |
FASEB J | proBDNF/p75NTR promotes rheumatoid arthritis and inflammatory response by activating proinflammatory cytokines [Pubmed:35129860] |
Cell Death Discov | Itaconate inhibits ferroptosis of macrophage via Nrf2 pathways against sepsis-induced acute lung injury [Pubmed:35110526] |
Chin Med | Red yeast rice ameliorates non-alcoholic fatty liver disease through inhibiting lipid synthesis and NF-κB/NLRP3 inflammasome-mediated hepatic inflammation?… [Pubmed:35078487] |
J Dairy Sci | Intake of Bifidobacterium lactis Probio-M8 fermented milk protects against alcoholic liver disease [Pubmed:35086715] |
Exp Biol Med (Maywood) | Protective antioxidative and anti-inflammatory actions of β-caryophyllene against sulfasalazine-induced nephrotoxicity in rat [Pubmed:35068213] |
Peptides | Osteocrin alleviates cardiac hypertrophy via attenuating oxidative stress [Pubmed:35218795] |
Int Immunopharmacol | LncRNA KCNQ1OT1 attenuates myocardial injury induced by hip fracture via regulating of miR-224-3p/GATA4 axis [Pubmed:35217336] |
Antioxidants (Basel) | Vitamin K2 (Menaquinone-7) Reverses Age-Related Structural and Cognitive Deterioration in Naturally Aging Rats [Pubmed:35326164] |
PLoS One | Investigation of the active ingredients and pharmacological mechanisms of Porana sinensis Hemsl. Against rheumatoid arthritis using network pharmacology?… [Pubmed:35235611] |
Free Radic Biol Med | Silica nanoparticles induce pyroptosis and cardiac hypertrophy via ROS/NLRP3/Caspase-1 pathway [Pubmed:35219847] |
Molecular Biotechnology | MiR-199a-3p Restrains Foaming and Inflammation by Regulating RUNX1 in Macrophages [Pubmed:35435591] |
International Heart Journal | Melatonin Inhibits OGD/R-Induced H9c2 Cardiomyocyte Pyroptosis via Regulation of MT2/miR-155/FOXO3a/ARC Axis [Pubmed:35354753] |
Journal of Integrative Neuroscience | Gastrodin suppresses pyroptosis and exerts neuroprotective effect in traumatic brain injury model by inhibiting NLRP3 inflammasome signaling pathway [Pubmed:35364660] |
Neurochem Res | Effects of Ethanolic Extract of Cynara cardunculus (Artichoke) Leaves on Neuroinflammatory and Neurochemical Parameters in a Diet-Induced Mice Obesity Model [Pubmed:35426598] |
Inflammopharmacology | Silymarin constrains diacetyl-prompted oxidative stress and neuroinflammation in rats: involvements of Dyn/GDNF and MAPK signaling pathway [Pubmed:35366745] |
Evid Based Complement Alternat Med | Loureirin B Alleviates Myocardial Ischemia/Reperfusion Injury via Inhibiting PAI-1/TGF-β1/Smad Signaling Pathway [Pubmed:35535157] |
Perfusion | Insulin reduces pyroptosis-induced inflammation by PDHA1 dephosphorylation-mediated NLRP3 activation during myocardial ischemia-reperfusion injury [Pubmed:35506656] |
Eur J Pharmacol | Potential cardioprotective effect of octreotide via NOXs mitigation, mitochondrial biogenesis and MAPK/Erk1/2/STAT3/NF-kβ pathway attenuation in isoproterenol?… [Pubmed:35500641] |
J Clin Med | Endometrial Dysbiosis Is Related to Inflammatory Factors in Women with Repeated Implantation Failure: A Pilot Study [Pubmed:35566605] |
Expert Opinion on Therapeutic Targets | Dapagliflozin mitigates ovalbumin-prompted airway inflammatory-oxidative successions and associated bronchospasm in a rat model of allergic asthma [Pubmed:35549595] |
American Journal of Translational Research | Curcumin treats endometriosis in mice by the HIF signaling pathway [Pubmed:35559378] |
Mol Immunol | Oridonin alleviates kanamycin-related hearing loss by inhibiting NLRP3/caspase-1/gasdermin D-induced inflammasome activation and hair cell pyroptosis [Pubmed:35749835] |
J Biomed Mater Res B Appl Biomater | Hybrid system with stable structure of hard/soft tissue substitutes induces re‐osseointegration in a rat model of biofilm‐mediated peri‐implantitis [Pubmed:35620882] |
Ecotoxicol Environ Saf | Ambient ozone exposure induces ROS related-mitophagy and pyroptosis via NLRP3 inflammasome activation in rat lung cells [Pubmed:35642860] |
Evaluation of Tubular Dysfunction Using Urine Biomarkers in Children with COVID-19 [Pubmed:35110086] | |
Poultry Science | Modulation of the innate immune system by lipopolysaccharide in the proventriculus of chicks inoculated with or without Newcastle disease and infectious?… [Pubmed:35247652] |
Antioxidants | Bio-Evaluation of the Wound Healing Activity of Artemisia judaica L. as Part of the Plant's Use in Traditional Medicine; Phytochemical, Antioxidant, Anti-Inflammatory?… [Pubmed:35204215] |
Antioxidants | Therapeutic Effects of Bee Bread on Obesity-Induced Testicular-Derived Oxidative Stress, Inflammation, and Apoptosis in High-Fat Diet Obese Rat Model?… [Pubmed:35204140] |
Oxidative Medicine and Cellular Longevity | The Role of Aeromonas-Goblet Cell Interactions in Melatonin-Mediated Improvements in Sleep Deprivation-Induced Colitis [Pubmed:35355860] |
Oxidative Medicine and Cellular Longevity | Rhein Ameliorates Cognitive Impairment in an APP/PS1 Transgenic Mouse Model of Alzheimer's Disease by Relieving Oxidative Stress through Activating the?… [Pubmed:35360200] |
Veterinary World | Pro-inflammatory cytokine release from chicken peripheral blood mononuclear cells stimulated with lipopolysaccharide [Pubmed:35698506] |
Glycation renders alpha-synuclein oligomeric strain and modulates microglia activation [] | |
Pyroptosis Accelerates Spiral Ganglion Neuronal Degeneration Induced by Aminoglycosides in the Cochlea [] | |
researchsquare | Dexmedetomidine Attenuates Hyperalgesia Induced By Brachial Plexus Root Avulsion By Restoring The GLT-1 Function Via PKA Signaling [] |
留言咨詢